ID: 937348571

View in Genome Browser
Species Human (GRCh38)
Location 2:121143894-121143916
Sequence TCAACAGCACCGAGGTTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937348571_937348574 -10 Left 937348571 2:121143894-121143916 CCGCTGAACCTCGGTGCTGTTGA No data
Right 937348574 2:121143907-121143929 GTGCTGTTGATGCCTTTGCTGGG No data
937348571_937348576 -8 Left 937348571 2:121143894-121143916 CCGCTGAACCTCGGTGCTGTTGA No data
Right 937348576 2:121143909-121143931 GCTGTTGATGCCTTTGCTGGGGG No data
937348571_937348575 -9 Left 937348571 2:121143894-121143916 CCGCTGAACCTCGGTGCTGTTGA No data
Right 937348575 2:121143908-121143930 TGCTGTTGATGCCTTTGCTGGGG No data
937348571_937348577 -7 Left 937348571 2:121143894-121143916 CCGCTGAACCTCGGTGCTGTTGA No data
Right 937348577 2:121143910-121143932 CTGTTGATGCCTTTGCTGGGGGG No data
937348571_937348579 12 Left 937348571 2:121143894-121143916 CCGCTGAACCTCGGTGCTGTTGA No data
Right 937348579 2:121143929-121143951 GGGGCTGTCCTGCGCATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937348571 Original CRISPR TCAACAGCACCGAGGTTCAG CGG (reversed) Intergenic
No off target data available for this crispr