ID: 937348572 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:121143902-121143924 |
Sequence | CAAAGGCATCAACAGCACCG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
937348572_937348581 | 24 | Left | 937348572 | 2:121143902-121143924 | CCTCGGTGCTGTTGATGCCTTTG | No data | ||
Right | 937348581 | 2:121143949-121143971 | AGGATGTTTAGCAGCATCTCTGG | No data | ||||
937348572_937348579 | 4 | Left | 937348572 | 2:121143902-121143924 | CCTCGGTGCTGTTGATGCCTTTG | No data | ||
Right | 937348579 | 2:121143929-121143951 | GGGGCTGTCCTGCGCATTGCAGG | No data | ||||
937348572_937348582 | 25 | Left | 937348572 | 2:121143902-121143924 | CCTCGGTGCTGTTGATGCCTTTG | No data | ||
Right | 937348582 | 2:121143950-121143972 | GGATGTTTAGCAGCATCTCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
937348572 | Original CRISPR | CAAAGGCATCAACAGCACCG AGG (reversed) | Intergenic | ||