ID: 937348572

View in Genome Browser
Species Human (GRCh38)
Location 2:121143902-121143924
Sequence CAAAGGCATCAACAGCACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937348572_937348582 25 Left 937348572 2:121143902-121143924 CCTCGGTGCTGTTGATGCCTTTG No data
Right 937348582 2:121143950-121143972 GGATGTTTAGCAGCATCTCTGGG No data
937348572_937348581 24 Left 937348572 2:121143902-121143924 CCTCGGTGCTGTTGATGCCTTTG No data
Right 937348581 2:121143949-121143971 AGGATGTTTAGCAGCATCTCTGG 0: 71
1: 274
2: 938
3: 1462
4: 1677
937348572_937348579 4 Left 937348572 2:121143902-121143924 CCTCGGTGCTGTTGATGCCTTTG No data
Right 937348579 2:121143929-121143951 GGGGCTGTCCTGCGCATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937348572 Original CRISPR CAAAGGCATCAACAGCACCG AGG (reversed) Intergenic
No off target data available for this crispr