ID: 937348579

View in Genome Browser
Species Human (GRCh38)
Location 2:121143929-121143951
Sequence GGGGCTGTCCTGCGCATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937348572_937348579 4 Left 937348572 2:121143902-121143924 CCTCGGTGCTGTTGATGCCTTTG No data
Right 937348579 2:121143929-121143951 GGGGCTGTCCTGCGCATTGCAGG No data
937348571_937348579 12 Left 937348571 2:121143894-121143916 CCGCTGAACCTCGGTGCTGTTGA No data
Right 937348579 2:121143929-121143951 GGGGCTGTCCTGCGCATTGCAGG No data
937348569_937348579 18 Left 937348569 2:121143888-121143910 CCCAGGCCGCTGAACCTCGGTGC No data
Right 937348579 2:121143929-121143951 GGGGCTGTCCTGCGCATTGCAGG No data
937348570_937348579 17 Left 937348570 2:121143889-121143911 CCAGGCCGCTGAACCTCGGTGCT No data
Right 937348579 2:121143929-121143951 GGGGCTGTCCTGCGCATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937348579 Original CRISPR GGGGCTGTCCTGCGCATTGC AGG Intergenic
No off target data available for this crispr