ID: 937348582

View in Genome Browser
Species Human (GRCh38)
Location 2:121143950-121143972
Sequence GGATGTTTAGCAGCATCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937348578_937348582 8 Left 937348578 2:121143919-121143941 CCTTTGCTGGGGGGCTGTCCTGC No data
Right 937348582 2:121143950-121143972 GGATGTTTAGCAGCATCTCTGGG No data
937348572_937348582 25 Left 937348572 2:121143902-121143924 CCTCGGTGCTGTTGATGCCTTTG No data
Right 937348582 2:121143950-121143972 GGATGTTTAGCAGCATCTCTGGG No data
937348580_937348582 -10 Left 937348580 2:121143937-121143959 CCTGCGCATTGCAGGATGTTTAG No data
Right 937348582 2:121143950-121143972 GGATGTTTAGCAGCATCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937348582 Original CRISPR GGATGTTTAGCAGCATCTCT GGG Intergenic
No off target data available for this crispr