ID: 937348635

View in Genome Browser
Species Human (GRCh38)
Location 2:121144282-121144304
Sequence TTGCCTCAGGCGAAATTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937348635_937348637 19 Left 937348635 2:121144282-121144304 CCTGAGAATTTCGCCTGAGGCAA No data
Right 937348637 2:121144324-121144346 GCTAAGTTCACTGAGAATGCAGG No data
937348635_937348638 20 Left 937348635 2:121144282-121144304 CCTGAGAATTTCGCCTGAGGCAA No data
Right 937348638 2:121144325-121144347 CTAAGTTCACTGAGAATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937348635 Original CRISPR TTGCCTCAGGCGAAATTCTC AGG (reversed) Intergenic
No off target data available for this crispr