ID: 937349707

View in Genome Browser
Species Human (GRCh38)
Location 2:121153151-121153173
Sequence CTCTGGCGTGGTCCTCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937349702_937349707 7 Left 937349702 2:121153121-121153143 CCTGGAGATGGGACAGGAGGGAA No data
Right 937349707 2:121153151-121153173 CTCTGGCGTGGTCCTCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937349707 Original CRISPR CTCTGGCGTGGTCCTCATGG AGG Intergenic
No off target data available for this crispr