ID: 937353658

View in Genome Browser
Species Human (GRCh38)
Location 2:121184793-121184815
Sequence TCCAGGACTCAGACTTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937353658_937353664 5 Left 937353658 2:121184793-121184815 CCCACCTAAGTCTGAGTCCTGGA No data
Right 937353664 2:121184821-121184843 GTGTCCTTTTAGCCACATCTGGG No data
937353658_937353667 19 Left 937353658 2:121184793-121184815 CCCACCTAAGTCTGAGTCCTGGA No data
Right 937353667 2:121184835-121184857 ACATCTGGGTCCATTTGCCCAGG No data
937353658_937353663 4 Left 937353658 2:121184793-121184815 CCCACCTAAGTCTGAGTCCTGGA No data
Right 937353663 2:121184820-121184842 AGTGTCCTTTTAGCCACATCTGG No data
937353658_937353668 26 Left 937353658 2:121184793-121184815 CCCACCTAAGTCTGAGTCCTGGA No data
Right 937353668 2:121184842-121184864 GGTCCATTTGCCCAGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937353658 Original CRISPR TCCAGGACTCAGACTTAGGT GGG (reversed) Intergenic
No off target data available for this crispr