ID: 937354834

View in Genome Browser
Species Human (GRCh38)
Location 2:121191806-121191828
Sequence GCATTAATAAGTCTTTGTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937354829_937354834 21 Left 937354829 2:121191762-121191784 CCAAGGGACTTCGTAGTAAGTGG No data
Right 937354834 2:121191806-121191828 GCATTAATAAGTCTTTGTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937354834 Original CRISPR GCATTAATAAGTCTTTGTTA CGG Intergenic
No off target data available for this crispr