ID: 937359423

View in Genome Browser
Species Human (GRCh38)
Location 2:121218655-121218677
Sequence TCCCATCAGCTGCCCTGCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 220}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937359416_937359423 6 Left 937359416 2:121218626-121218648 CCAAGCACTGACCGTCCTTCCCC 0: 1
1: 0
2: 2
3: 15
4: 228
Right 937359423 2:121218655-121218677 TCCCATCAGCTGCCCTGCACAGG 0: 1
1: 0
2: 2
3: 36
4: 220
937359413_937359423 26 Left 937359413 2:121218606-121218628 CCAGGCTGGCCAGCTGGGGCCCA 0: 1
1: 0
2: 4
3: 54
4: 512
Right 937359423 2:121218655-121218677 TCCCATCAGCTGCCCTGCACAGG 0: 1
1: 0
2: 2
3: 36
4: 220
937359418_937359423 -9 Left 937359418 2:121218641-121218663 CCTTCCCCACCTTATCCCATCAG 0: 1
1: 0
2: 1
3: 46
4: 403
Right 937359423 2:121218655-121218677 TCCCATCAGCTGCCCTGCACAGG 0: 1
1: 0
2: 2
3: 36
4: 220
937359414_937359423 17 Left 937359414 2:121218615-121218637 CCAGCTGGGGCCCAAGCACTGAC 0: 1
1: 0
2: 1
3: 33
4: 230
Right 937359423 2:121218655-121218677 TCCCATCAGCTGCCCTGCACAGG 0: 1
1: 0
2: 2
3: 36
4: 220
937359417_937359423 -5 Left 937359417 2:121218637-121218659 CCGTCCTTCCCCACCTTATCCCA 0: 1
1: 0
2: 4
3: 87
4: 814
Right 937359423 2:121218655-121218677 TCCCATCAGCTGCCCTGCACAGG 0: 1
1: 0
2: 2
3: 36
4: 220
937359415_937359423 7 Left 937359415 2:121218625-121218647 CCCAAGCACTGACCGTCCTTCCC 0: 1
1: 0
2: 0
3: 5
4: 121
Right 937359423 2:121218655-121218677 TCCCATCAGCTGCCCTGCACAGG 0: 1
1: 0
2: 2
3: 36
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937359423 Original CRISPR TCCCATCAGCTGCCCTGCAC AGG Exonic
900169301 1:1258545-1258567 TCCCATCAGGAGCCCTGCAATGG + Intronic
900248765 1:1654595-1654617 TCTCATCAGCGGCCCTCCTCAGG + Intronic
900308912 1:2024197-2024219 CCCCATCTGCTCACCTGCACTGG - Intronic
900767779 1:4516837-4516859 TCCCATCAGAAGCCCGGGACTGG + Intergenic
901640097 1:10688780-10688802 ACCAAGCTGCTGCCCTGCACAGG + Intronic
901777509 1:11570499-11570521 GCCCCTCAGGTTCCCTGCACAGG - Intergenic
904314880 1:29653609-29653631 ACCCATCAGTTCCCCTGCACTGG + Intergenic
904403941 1:30274309-30274331 TCCCATCATCTGCTCAGCTCTGG + Intergenic
904841327 1:33373693-33373715 TCCCAGTTGATGCCCTGCACTGG + Intronic
904962284 1:34343450-34343472 TACCATCAGCTTCTTTGCACAGG - Intergenic
905874928 1:41426580-41426602 TCCCATCAGCTGCCAAGCTGGGG - Intergenic
906508953 1:46400385-46400407 ACCCAACTGCTGCCCTGCCCAGG - Intronic
906590486 1:47020569-47020591 TCCCAGCATGTGCCCAGCACAGG + Intergenic
907238718 1:53068940-53068962 TCCCCTCAGCTGCCCTCACCAGG - Intronic
907369613 1:53992500-53992522 TCCCAACATCTGCCCAGCTCTGG + Intergenic
908231947 1:62114014-62114036 TGCCATCAGCAGCCCAGCTCAGG + Intronic
909863053 1:80632993-80633015 CCCCATCACATGCCCTGCAAGGG + Intergenic
910477256 1:87620412-87620434 CCCCATCACATGCCCTGCAAGGG + Intergenic
912725566 1:112056466-112056488 TTCCCTCAGCTGCCCTGCAAAGG + Intergenic
913226661 1:116706491-116706513 TCCCTTCTGCTACCCTCCACAGG - Exonic
913550872 1:119915848-119915870 TCCCTTCAGGTGGCCTGCTCTGG + Exonic
913594156 1:120357270-120357292 TCCCAGAGGCTGCCCCGCACAGG - Intergenic
914093103 1:144521726-144521748 TCCCAGAGGCTGCCCTGCACAGG + Intergenic
914305423 1:146412158-146412180 TCCCAGAGGCTGCCCTGCACAGG - Intergenic
914596636 1:149160645-149160667 TCCCAGAGGCTGCCCTGCACAGG + Intergenic
914743579 1:150485092-150485114 TCAGATCAACTGCCCTGCCCGGG + Intergenic
914977219 1:152377841-152377863 CCCCATCACATGCCCTGCAAGGG - Intergenic
916797498 1:168180206-168180228 TCCCATCAGCTGGCCATCCCAGG - Intronic
916849985 1:168693979-168694001 TCCCCTCATCTGCCCAGTACAGG - Intergenic
919897461 1:202018248-202018270 TCCCAGGCGCTGCCCTGCAGAGG - Intergenic
920505593 1:206513240-206513262 TGCCAGCAGCTGCCCTCCATGGG - Intronic
921892413 1:220366516-220366538 TCCCAATAGCTGGCATGCACGGG + Intergenic
922886383 1:229024049-229024071 TCCCAGGAACTGCCCTGCCCTGG - Intergenic
1063009636 10:2009839-2009861 ACCTATCAGATGCCCTGCTCTGG + Intergenic
1069568422 10:69479303-69479325 TCCCAGCAGCTGCCTGGAACTGG + Intronic
1072687989 10:97550084-97550106 TCCCAACAGCTGGCCGGCAAGGG - Intronic
1075522807 10:123154284-123154306 TCCGCTCAGCTGCCCAGCATCGG - Exonic
1075820133 10:125300576-125300598 TCCCCTCAGTAGCCCTGCTCTGG - Intergenic
1076698393 10:132257800-132257822 ACCCATCAGCTGCCCTGGGCTGG + Intronic
1076872653 10:133201323-133201345 TCCCAGCATCTCCCCTGCACTGG + Intronic
1077215953 11:1395208-1395230 ACCCCTCATCTGCCCTGCACGGG + Intronic
1077905836 11:6532858-6532880 TCCAGTCAGCTGCTATGCACTGG - Intronic
1078107054 11:8365165-8365187 GCCACTCAGCTGCCCTCCACAGG + Intergenic
1080052354 11:27870306-27870328 TTCCATCTCATGCCCTGCACAGG + Intergenic
1082029463 11:47594129-47594151 TCCCCTCAGCTGCCCTCACCTGG + Exonic
1084205935 11:67592980-67593002 CCCCATCACATGCCCTGCAAGGG - Intergenic
1084523068 11:69676427-69676449 TCCCATCACCACCCCTGCTCAGG - Intergenic
1085047172 11:73360342-73360364 ACCTCTCAGCTGCCATGCACCGG + Exonic
1085619309 11:78025695-78025717 TCCAAGCAGCTGCCCTGGGCTGG - Intronic
1085752071 11:79170256-79170278 TCACATCAGGAGCCCAGCACTGG + Intronic
1085758541 11:79221916-79221938 TCCTCTCAGCTTCCCTGCCCTGG - Intronic
1086102923 11:83120133-83120155 TCCCATCAGATGGGCTGCAAAGG + Intergenic
1091223861 11:133946351-133946373 CCCCACCAGCTGCCCTCCATGGG + Intronic
1091710461 12:2736559-2736581 GCTCATCCGCTGCCCTGCAGTGG + Intergenic
1092569508 12:9707631-9707653 CCCCATCACATGCCCTGCAAGGG + Intergenic
1095349000 12:41188078-41188100 ACCCATCAGCAGCCCTGCCCAGG + Intergenic
1096786450 12:54019549-54019571 CCCCATCAGCGGCCATCCACAGG - Intronic
1098674589 12:73272834-73272856 TCCAATCCACTGCCCTCCACAGG - Intergenic
1101807029 12:108072980-108073002 TCAGAACAGCTGCCCTGCAGGGG - Intergenic
1102880626 12:116482098-116482120 TCCCATAAGGTGCCCAGCATAGG - Intergenic
1103554330 12:121756942-121756964 TGTCCTCAGCAGCCCTGCACGGG - Intronic
1103565470 12:121813068-121813090 TCCCAGCTGCAGCCCCGCACTGG + Intronic
1104979391 12:132567021-132567043 TCCCAACCACTGCCCAGCACAGG - Intronic
1108088304 13:46818526-46818548 GCCCATCCTCTGCCCTGCTCTGG - Intergenic
1108114515 13:47112210-47112232 TCCCTTCGGCTGCCATGTACTGG + Intergenic
1108176097 13:47794430-47794452 GCCCAGCACCTTCCCTGCACTGG + Intergenic
1110781072 13:79465366-79465388 TCTCACCACCTGCCCTCCACTGG - Intergenic
1110999929 13:82165545-82165567 GTCCATCCTCTGCCCTGCACTGG + Intergenic
1111512663 13:89287284-89287306 TCCCATCATCTTCTCTGCTCCGG + Intergenic
1111933376 13:94534683-94534705 TGCCATCGGCTGCCCTGGGCAGG + Intergenic
1112389131 13:98966770-98966792 TCCCAACACCTGCCCTTTACTGG - Intronic
1114470429 14:22957307-22957329 TCTCAGCATCTGCCCTTCACTGG - Intronic
1117636253 14:57746943-57746965 TGCCATCTCCTGCCCTACACAGG + Intronic
1118731552 14:68670373-68670395 TCCCACCAGCTGAACTGCAGAGG - Intronic
1121308643 14:92923181-92923203 TCCCGCAAGCTCCCCTGCACGGG - Exonic
1121649511 14:95547463-95547485 TGCCCTCAGCTCACCTGCACTGG - Intergenic
1123194589 14:106604350-106604372 TCCCATCAGCTGCAGAGCAGTGG - Intergenic
1123222550 14:106870665-106870687 TCCCATCAGCTGCAGAGCAGTGG - Intergenic
1124179050 15:27456202-27456224 TCACATCTACTGCCCTGGACAGG + Intronic
1126475593 15:49062599-49062621 CCCCATCACATGCCCTGCAAGGG - Intergenic
1127726370 15:61753847-61753869 TTCCATCAGCACCACTGCACTGG + Intergenic
1127894861 15:63288500-63288522 TACCATCATCTGCCCTCAACTGG + Intronic
1129167150 15:73785098-73785120 GCCCTTCAGCTGCTCTGCAATGG - Intergenic
1129674843 15:77626966-77626988 CCCCATCCGCAGCCCTGCACTGG + Intronic
1129826335 15:78637448-78637470 TCCCACCTGCTTCCCTGCCCCGG - Intronic
1133001177 16:2852502-2852524 CTCCATCGGCTGCCCTGCCCTGG + Intergenic
1133627499 16:7584906-7584928 TGACATCAGCTGCCCTGAAGTGG - Intronic
1133769698 16:8860611-8860633 CCCCATCACCAGCCCTGCGCAGG - Intronic
1135111029 16:19691049-19691071 TCACAGCAGCTGCCAGGCACTGG - Intronic
1135573072 16:23564137-23564159 TCCCATCATCTGACGTTCACTGG + Intronic
1140137897 16:72224110-72224132 TGCCATCAGCAGCCCAGCCCTGG - Intergenic
1141789645 16:86225866-86225888 TCCCATCAGGTGCCAGGCACTGG + Intergenic
1142129298 16:88425442-88425464 GCACATCTCCTGCCCTGCACTGG - Intergenic
1142157473 16:88539228-88539250 ACCCGTCCCCTGCCCTGCACAGG + Intergenic
1142386624 16:89769325-89769347 TCCCTGCAGCTGCCACGCACAGG - Intronic
1143481317 17:7229097-7229119 GCCACTGAGCTGCCCTGCACGGG - Intronic
1143684948 17:8506288-8506310 GCCCAGCAGCTGCGCTGCACGGG - Intronic
1144469540 17:15525217-15525239 TGCCATTAGGTGCCCGGCACTGG + Intronic
1144926815 17:18818458-18818480 TGCCATTAGGTGCCCGGCACTGG - Intergenic
1146474256 17:33150294-33150316 TCCCACCACCTGCCCAGTACAGG + Intronic
1147045114 17:37745799-37745821 CCCCAGCAGCTGGGCTGCACCGG + Intergenic
1148245035 17:46024904-46024926 TCCCACAGGCTGCCCTGCAGAGG - Exonic
1148551232 17:48551826-48551848 TCCCTCTAGCTGCCCTCCACCGG - Intronic
1148695644 17:49556532-49556554 TTCCATCAGAGGCCCTGAACAGG - Intergenic
1148777974 17:50106125-50106147 TCCCCTCAGCAGCCCGGCCCTGG - Intronic
1151231500 17:72688469-72688491 TGCCTTCAGCTGCCCTCCACTGG + Intronic
1152599418 17:81254200-81254222 CCCCATCTGCTGCTCTGAACTGG - Intronic
1153810488 18:8747876-8747898 TAGCCTCAGCAGCCCTGCACAGG + Intronic
1156160384 18:34351290-34351312 TCCCATCCTCTGCCCTGCTCTGG - Intergenic
1156447878 18:37250389-37250411 TCCCCACAGCTGCCCTGCCTAGG + Intronic
1156493575 18:37511230-37511252 ATGCATCAGCTGCCCTCCACAGG + Intronic
1156724326 18:40109849-40109871 TCTCATCAGCTGACTTCCACTGG + Intergenic
1157857722 18:51117279-51117301 GCCCAGCAGCTGCCCTGTCCGGG - Intergenic
1161621244 19:5298518-5298540 TCCTCTCAGCTTCCCTGCCCTGG + Intronic
1162042881 19:7980941-7980963 TCCCATCAGATACCCTGGTCAGG - Intronic
1165219936 19:34307212-34307234 TCCCATCCCCTGCCCTTCAGAGG - Intronic
1165767642 19:38361134-38361156 TCCCATCAGGGCCTCTGCACAGG - Intronic
1166759133 19:45213503-45213525 TCCAATCAGCTCCCTTGCCCAGG + Intronic
1166897510 19:46033039-46033061 TCCCATCATCTGCCCTGTGCTGG - Intergenic
1167646800 19:50710430-50710452 CCCCACCAGCTGCCCTTCAAGGG + Intronic
925602837 2:5626625-5626647 TCCAAGAGGCTGCCCTGCACAGG - Intergenic
926905233 2:17799405-17799427 CACCCTCAGCTGCCCAGCACTGG - Intronic
927098542 2:19767593-19767615 TCCTACCTGCTGCCCTGCAAAGG + Intergenic
927584076 2:24282731-24282753 CCCCATCACCTGCCCTTCAAGGG + Intronic
929563190 2:42968501-42968523 TACCAGCAGCTTCCCTGCCCAGG + Intergenic
931034696 2:58227084-58227106 TCCCATCGCATGCCCTGCAAGGG - Intronic
932721117 2:74139518-74139540 TCCCAACAGCTGTCCTGAGCAGG + Intronic
933793375 2:85901676-85901698 TCTCAGAAGCTGCCCTCCACAGG + Intergenic
934167669 2:89309680-89309702 TCCCATCAGCTGCCATGGCCTGG - Intergenic
934199616 2:89872903-89872925 TCCCATCAGCTGCCATGGCCTGG + Intergenic
934953127 2:98592901-98592923 TCCTGTGAGCTGGCCTGCACAGG + Intronic
937201023 2:120204615-120204637 TCCCAGCAGCTGCCCTGCTGTGG + Intergenic
937359423 2:121218655-121218677 TCCCATCAGCTGCCCTGCACAGG + Exonic
938382222 2:130843153-130843175 TCCCAGCAGCTGTTCAGCACGGG + Intronic
944753633 2:202736984-202737006 TCCCATCAGCAGCCTAGCATTGG - Intronic
945986521 2:216358904-216358926 TACCATCTGTTGCCCTGCTCTGG + Intronic
947834637 2:233166548-233166570 GCCCAGAAGCTGCCCTGCAATGG - Intronic
948831572 2:240600912-240600934 CACCATCAGGCGCCCTGCACAGG - Intronic
1168886881 20:1266360-1266382 TGGCTTCAGCTGCCCTGCAGGGG - Exonic
1169105869 20:2994013-2994035 TTCCATCAGCTGGCCTGCAAAGG + Intronic
1170119987 20:12901135-12901157 TCTCCTCAGGTCCCCTGCACAGG - Intergenic
1172052373 20:32128118-32128140 TCCCCTCAGCTGTGCAGCACTGG - Intronic
1175730326 20:61349880-61349902 TAGCATGAGCTGCCCTGCCCCGG - Intronic
1177076992 21:16588434-16588456 TTCCATCATCTGACCTGCAAAGG + Intergenic
1178277196 21:31249688-31249710 TCACACCAGCTGCTCTGCTCTGG - Intronic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1181003776 22:19999944-19999966 AGCCATCATCTTCCCTGCACTGG + Intronic
1181811479 22:25405793-25405815 TCCCCTCCTCTGCCCTCCACAGG - Intergenic
1183057185 22:35314230-35314252 TCCCAACAGCTGTCTTGTACTGG + Intronic
1184372579 22:44091987-44092009 TCCCATCACGTGCCATGCTCTGG + Intronic
1184554463 22:45225651-45225673 GCCCCTGAGCTGACCTGCACAGG - Intronic
1185280832 22:49969197-49969219 TCCGAGCACCTGCCCTGCACAGG - Intergenic
1185289021 22:50014816-50014838 TCCCATCTGGTGCCCAGCGCGGG - Intergenic
1185338471 22:50281272-50281294 CCTCATCCGCCGCCCTGCACAGG - Intronic
950942082 3:16902972-16902994 TACCATCATTTGCCATGCACTGG + Intronic
953153860 3:40350970-40350992 TCACATCAGGAACCCTGCACAGG - Intergenic
953376246 3:42430873-42430895 TCCCATCTCCTGCCCTCCACAGG - Intergenic
953971200 3:47348501-47348523 TCCTCTCAGCTGCCCAGCAGCGG + Intergenic
957926219 3:86815361-86815383 TCCCAACAGCTGCCAGTCACAGG - Intergenic
958021609 3:88004161-88004183 GCCCATTAGCTGTCCTGCAGAGG + Intergenic
961431838 3:126889217-126889239 TGCCCTCAGCAGCCCTGCCCTGG - Intronic
961531077 3:127540789-127540811 TGCCACCAGCTGCCCTACAGTGG - Intergenic
963914653 3:150847160-150847182 TCACATCAGCTTTCCTGCATGGG + Intergenic
964684189 3:159376771-159376793 GCCCATAAGCTGCGGTGCACTGG - Intronic
966498010 3:180602409-180602431 TCTCATTACCTGCCCTGCAACGG - Exonic
966834461 3:184038528-184038550 TCCCTGCTGCTGCACTGCACCGG + Exonic
967374013 3:188780865-188780887 TGGAATCAGCTGCCCAGCACTGG - Intronic
968144585 3:196287708-196287730 TTCCATCAGCTGCCTTCCCCGGG - Exonic
968576098 4:1366864-1366886 TGCCATCCGCAGCCCTGCTCAGG + Intronic
968596243 4:1487323-1487345 TCCCAGCTGCTTCCCTGCAGGGG + Intergenic
968628212 4:1637552-1637574 TCCCCTCAGGAGCCCTCCACAGG + Intronic
968902451 4:3438076-3438098 TACCAACTGCTGCCCTCCACAGG - Intronic
968952273 4:3701358-3701380 TCCCTGCCACTGCCCTGCACTGG + Intergenic
969286724 4:6207135-6207157 TCCCATCAGCCTCCATGCAAAGG - Intergenic
969590059 4:8116783-8116805 TCACAGCAGCTTCCCTGCTCTGG + Intronic
971251535 4:24976743-24976765 TGCCATCATCTGGCCTGCGCTGG + Intronic
975913699 4:79298012-79298034 TCCCATCATCTGCTCTGCTCTGG - Intronic
976344208 4:83981526-83981548 TTCCATTATCTGTCCTGCACAGG + Intergenic
977552403 4:98456391-98456413 ACCCATCAGGGGCCCTGCAAGGG - Intergenic
979343095 4:119551344-119551366 TCCCATGAGCTAACCTACACTGG + Intronic
979448180 4:120839510-120839532 TTCCATCATCTGCTCTGCTCTGG + Intronic
981247510 4:142557183-142557205 TCCCATCAGCTGCCCTACCCTGG - Intronic
984928528 4:184826578-184826600 GGCCCTCAGCTCCCCTGCACCGG - Exonic
985109933 4:186538456-186538478 TCTCATCTGCTGCCCTGCAGGGG + Intronic
985907271 5:2849631-2849653 TCCCAACAGCAGCTCTTCACTGG + Intergenic
990585481 5:57207374-57207396 CCCCATCACATGCCCTGCAAAGG - Intronic
991124413 5:63053279-63053301 GCTCACCAGCTGCCCTGCAAAGG + Intergenic
992230565 5:74659375-74659397 GCCCTCCACCTGCCCTGCACTGG - Intronic
992660664 5:78957736-78957758 TCCCAACAGATGCCCTGCCTGGG + Intronic
993959194 5:94276047-94276069 TGACATCTGCTGCACTGCACAGG + Intronic
997236526 5:132275173-132275195 TTCCTTCAGCTGCCCTGAAATGG - Intronic
998158811 5:139801562-139801584 CCCCAGCACTTGCCCTGCACAGG + Intronic
998365860 5:141630307-141630329 TCCCATCCAGTGCCTTGCACAGG - Intronic
999092616 5:148950512-148950534 TCCCATAAGGTGCCAGGCACAGG - Intronic
999664495 5:153898468-153898490 TCACAAAAACTGCCCTGCACTGG + Intergenic
999701410 5:154231884-154231906 GCCCATCAGCTTTTCTGCACAGG + Intronic
1001290209 5:170451938-170451960 TCCCAGGAGCTGCCCTGCCCAGG + Intronic
1002171740 5:177378511-177378533 TTCCTTCAGCTCCCCAGCACTGG - Intergenic
1005495015 6:26380850-26380872 TCCCAACAGCTGCCCAGTCCTGG + Intergenic
1005620626 6:27617027-27617049 TCTCAAAAACTGCCCTGCACAGG + Intergenic
1006092715 6:31637450-31637472 CCCCACCAGATGCCCTGCGCTGG + Exonic
1006899568 6:37491156-37491178 CCCCATCAGCTGACCTGGCCAGG - Intronic
1007332142 6:41120514-41120536 TCCCTGCAGCTACCCTTCACAGG + Intergenic
1007387759 6:41531066-41531088 TCCCAAGAGCCTCCCTGCACTGG + Intergenic
1007746489 6:44046496-44046518 TCCCATCTGCTCTCCTCCACAGG + Intergenic
1009593177 6:65700758-65700780 TCCCATCTGCTTCCTTTCACAGG + Intronic
1011149510 6:84254645-84254667 CCTCATCTGCTGCCCTGCCCTGG + Intergenic
1012497253 6:99847342-99847364 TCTGCTCAGCTTCCCTGCACCGG - Intergenic
1020007601 7:4790788-4790810 GCCCCTCTGCTGCCCTGCCCAGG + Exonic
1022289963 7:28991236-28991258 TCCCATCAGGCACCCTGCTCCGG - Intergenic
1022769507 7:33454122-33454144 CCCCATCTCCTGCCCTGCATGGG + Intronic
1023044434 7:36198891-36198913 TCCCACCAGCTGCACTGCTCAGG - Intronic
1023166697 7:37350032-37350054 TCCCCCCACCTGCCCTACACTGG + Intronic
1023878432 7:44305551-44305573 TCCCCTGAGGTGCCCTGCACTGG + Intronic
1024293802 7:47827161-47827183 TCCCATCTGCTGGGCAGCACAGG + Intronic
1024379686 7:48681990-48682012 GCTCACCAGCTTCCCTGCACTGG + Intergenic
1026067669 7:67089371-67089393 CCCCACCAGATGCCCTGCACTGG - Intronic
1026709256 7:72722960-72722982 CCCCACCAGATGCCCTGCACTGG + Intronic
1026871394 7:73854805-73854827 TCCCATACGCTGCCCCTCACAGG + Intergenic
1029156511 7:98521326-98521348 TCCCATCGTCTTCCCTGCAGAGG + Intergenic
1029354953 7:100044914-100044936 TGCCATCAGCTGGCCAGCAGAGG - Intergenic
1029629869 7:101743637-101743659 GCCCATCACCTGAGCTGCACCGG - Intergenic
1031998724 7:128250409-128250431 TCCCAGCAGCTGCCCTTGACTGG + Intronic
1032545386 7:132737617-132737639 TCCCCACAGCTTCCCTGCCCTGG + Intergenic
1034540341 7:151754432-151754454 CCTCATCAGCTGCCCTGGTCCGG + Intronic
1035251364 7:157599653-157599675 TCCCTTCACCTGCCCCGCAGTGG - Intronic
1035418613 7:158709201-158709223 CCCTCACAGCTGCCCTGCACTGG - Intergenic
1035588960 8:798623-798645 ACCCATCACCTGGCCAGCACCGG - Intergenic
1035734880 8:1880971-1880993 TCCCATCAGACACCCTGCAGGGG - Intronic
1036700671 8:11011836-11011858 TGCCATGTGCTGCCCTGCAGTGG - Intronic
1036772778 8:11590506-11590528 TCCACGCAGCTGCACTGCACAGG - Intergenic
1043358468 8:79441440-79441462 TCCCATCAGCAGCACTCAACAGG - Intergenic
1047366083 8:124212841-124212863 TCCCATCAGGTGCACAGGACGGG + Intergenic
1048266384 8:132991110-132991132 TACCATGAGCTGCCCTGAGCAGG + Intronic
1048541191 8:135343643-135343665 TCCCATCATCTGACCTGCTGCGG + Intergenic
1049397825 8:142409788-142409810 TCCTATGAGCTGCTCTGCAAAGG + Intergenic
1054753827 9:68936787-68936809 TCTCCTAAGCTCCCCTGCACTGG + Intronic
1056986136 9:91364764-91364786 TCCCATCATCTGCTCAGCTCTGG - Intergenic
1057510312 9:95673374-95673396 TCCCATCAACTCCCATGAACTGG - Intergenic
1058206728 9:102118240-102118262 TCCCATCACATGCCCTGCAAGGG - Intergenic
1058696962 9:107566681-107566703 TCCCATCCCCTGCCCTGTTCTGG - Intergenic
1060129905 9:121086377-121086399 TCACTTCATCTGCCCTGCACTGG + Intronic
1060556802 9:124512200-124512222 CCCCCTCCGCTGCCCTGCACGGG - Intergenic
1060970923 9:127737357-127737379 TCCTATCCCCTGCCCTGCCCTGG - Intergenic
1061091298 9:128428069-128428091 TCCCAGCGGGTGCCCTGGACAGG + Intronic
1062261762 9:135666460-135666482 TCCCATCAGATGCCCTTCACAGG + Intergenic
1062264902 9:135682488-135682510 TCCCATCCTCTGTCCTTCACGGG + Intergenic
1062729697 9:138102057-138102079 CCCCAGCAGCAGCCCTGCCCTGG + Intronic
1185761119 X:2690777-2690799 TCCCAGCAGCTCCCCTGCTCGGG - Intergenic
1188620121 X:32210391-32210413 TACCATCTGTTGCCCTTCACTGG - Intronic
1190865530 X:54381546-54381568 TCCCATCTGCTGCTCAGAACAGG + Intergenic
1190998856 X:55637808-55637830 TCCCATCCTCTGCCCTGCTCTGG - Intergenic
1192763304 X:74118789-74118811 TACCAGCAGCTACCCTGCAGAGG + Intergenic
1193823200 X:86191470-86191492 TCCCACCCGCTACCCTACACTGG - Intronic
1193888929 X:87018254-87018276 GCCCATCAGCTTCCCTGCAATGG + Intergenic
1194000601 X:88424371-88424393 TCCCAGCAGCTTCCTTGCTCTGG - Intergenic
1195747920 X:108137272-108137294 TCCCCTAAGCTCCCCTGCCCTGG - Intronic
1198792885 X:140364822-140364844 TCCCATCGGCTGCCCCACAGAGG + Intergenic
1200141418 X:153904688-153904710 CTCCATCGGCTGCCCTGCCCTGG - Intronic