ID: 937361877

View in Genome Browser
Species Human (GRCh38)
Location 2:121235224-121235246
Sequence CGGCTCTTCAACGCCATCAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937361877_937361879 -9 Left 937361877 2:121235224-121235246 CCTTTGATGGCGTTGAAGAGCCG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 937361879 2:121235238-121235260 GAAGAGCCGGATCCCATCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 90
937361877_937361886 20 Left 937361877 2:121235224-121235246 CCTTTGATGGCGTTGAAGAGCCG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 937361886 2:121235267-121235289 AGATCTGGACCAAATCATCTCGG 0: 1
1: 0
2: 0
3: 12
4: 131
937361877_937361887 21 Left 937361877 2:121235224-121235246 CCTTTGATGGCGTTGAAGAGCCG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 937361887 2:121235268-121235290 GATCTGGACCAAATCATCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 81
937361877_937361880 -8 Left 937361877 2:121235224-121235246 CCTTTGATGGCGTTGAAGAGCCG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 937361880 2:121235239-121235261 AAGAGCCGGATCCCATCTGCGGG 0: 1
1: 0
2: 1
3: 11
4: 77
937361877_937361884 5 Left 937361877 2:121235224-121235246 CCTTTGATGGCGTTGAAGAGCCG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 937361884 2:121235252-121235274 CATCTGCGGGACCACAGATCTGG 0: 1
1: 0
2: 1
3: 9
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937361877 Original CRISPR CGGCTCTTCAACGCCATCAA AGG (reversed) Exonic
920829996 1:209455902-209455924 CAGCTCTTCCACACAATCAATGG + Intergenic
1068648317 10:59493537-59493559 CAGCTCGTCAATGCCATCACTGG + Intergenic
1073199923 10:101727059-101727081 CGGCTCCTCCACCCCATCCAAGG - Intergenic
1091995208 12:4987845-4987867 AGGCTATTCACCGCCATCAGGGG + Intergenic
1104103758 12:125639969-125639991 CGGCTCCTCTAGGCCATCGAGGG + Intronic
1104461843 12:128962612-128962634 CCGCTCTTCAACAGCAGCAAGGG - Intronic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1112371143 13:98794681-98794703 CACATCTTCAACGCCATCAGTGG - Exonic
1119095336 14:71824730-71824752 CTGCTCTTCAAGACCATCGAGGG - Intergenic
1132250739 15:100333776-100333798 TGTTTCTTCATCGCCATCAATGG - Intronic
1134008070 16:10831649-10831671 CGACTCTGCAACCCCATCTAAGG - Intergenic
1135284481 16:21181663-21181685 GGCTTCTTCAAAGCCATCAAGGG + Intergenic
1144109795 17:12020868-12020890 CGGCTCTTCACTCCCAACAATGG + Exonic
1151247162 17:72803786-72803808 CTTCTCTTCAAGGCCATCCAGGG - Intronic
1155594299 18:27466923-27466945 GGGCTCCACAAAGCCATCAATGG + Intergenic
933754892 2:85630600-85630622 TGGCTCTTTAAGGCCATCACAGG + Intronic
937361877 2:121235224-121235246 CGGCTCTTCAACGCCATCAAAGG - Exonic
937398083 2:121556327-121556349 CCTCTCTTCAACACCATCCAAGG + Intronic
1168962427 20:1878331-1878353 CCCCTCCTCATCGCCATCAAGGG - Intergenic
1172386950 20:34540762-34540784 CGGCTCTTCTCCCCCACCAACGG + Exonic
1182848684 22:33452664-33452686 CAGCATTTCAGCGCCATCAAAGG + Intronic
1184747315 22:46463853-46463875 CGGCCCATCCACCCCATCAACGG - Exonic
962921559 3:139954724-139954746 CAGCTGTTCCACACCATCAAAGG - Intronic
967048958 3:185764519-185764541 GGTCTCTTCACCTCCATCAAGGG - Intronic
977100959 4:92814589-92814611 CTCCTCTTCAAAGCCATCTAAGG + Intronic
985854566 5:2414870-2414892 CAGCTTGTCAACGCCATAAAAGG - Intergenic
986049046 5:4070046-4070068 TGACTCTTCAAAGCCAGCAAAGG + Intergenic
1010218045 6:73422347-73422369 CGATTCTTCAAAGCCAGCAAGGG - Intronic
1032463017 7:132125838-132125860 CAGCTCTTCAAGGCCTTCAAGGG - Exonic
1033306985 7:140231959-140231981 GGGCTCTTTAACTACATCAAAGG + Intergenic
1035650132 8:1257689-1257711 CGGCTCTTCCACGCCAGCACTGG - Intergenic
1037305594 8:17500126-17500148 CTGCTCTTAAAATCCATCAATGG - Intronic
1038647718 8:29374902-29374924 CAGCTCTTCCACGACATCACAGG - Intergenic
1200982751 Y:9277151-9277173 GGGCTCCTCAATGCCATCACAGG + Intergenic
1202127633 Y:21582526-21582548 GGGCTCCTCAATGCCATCACAGG - Intergenic