ID: 937368073

View in Genome Browser
Species Human (GRCh38)
Location 2:121279480-121279502
Sequence ATCCCCAAGGGCAGCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937368073_937368079 17 Left 937368073 2:121279480-121279502 CCAGCAGAGCTGCCCTTGGGGAT No data
Right 937368079 2:121279520-121279542 TGCGGCCCCTCCACAATGAGAGG No data
937368073_937368082 20 Left 937368073 2:121279480-121279502 CCAGCAGAGCTGCCCTTGGGGAT No data
Right 937368082 2:121279523-121279545 GGCCCCTCCACAATGAGAGGGGG No data
937368073_937368081 19 Left 937368073 2:121279480-121279502 CCAGCAGAGCTGCCCTTGGGGAT No data
Right 937368081 2:121279522-121279544 CGGCCCCTCCACAATGAGAGGGG No data
937368073_937368080 18 Left 937368073 2:121279480-121279502 CCAGCAGAGCTGCCCTTGGGGAT No data
Right 937368080 2:121279521-121279543 GCGGCCCCTCCACAATGAGAGGG No data
937368073_937368076 -1 Left 937368073 2:121279480-121279502 CCAGCAGAGCTGCCCTTGGGGAT No data
Right 937368076 2:121279502-121279524 TAAAGCATCACCTTCCACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937368073 Original CRISPR ATCCCCAAGGGCAGCTCTGC TGG (reversed) Intronic