ID: 937368074

View in Genome Browser
Species Human (GRCh38)
Location 2:121279492-121279514
Sequence AGGTGATGCTTTATCCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937368074_937368089 29 Left 937368074 2:121279492-121279514 CCCTTGGGGATAAAGCATCACCT No data
Right 937368089 2:121279544-121279566 GGTTGCTTCTACCCAGAGGGAGG No data
937368074_937368081 7 Left 937368074 2:121279492-121279514 CCCTTGGGGATAAAGCATCACCT No data
Right 937368081 2:121279522-121279544 CGGCCCCTCCACAATGAGAGGGG No data
937368074_937368080 6 Left 937368074 2:121279492-121279514 CCCTTGGGGATAAAGCATCACCT No data
Right 937368080 2:121279521-121279543 GCGGCCCCTCCACAATGAGAGGG No data
937368074_937368079 5 Left 937368074 2:121279492-121279514 CCCTTGGGGATAAAGCATCACCT No data
Right 937368079 2:121279520-121279542 TGCGGCCCCTCCACAATGAGAGG No data
937368074_937368087 25 Left 937368074 2:121279492-121279514 CCCTTGGGGATAAAGCATCACCT No data
Right 937368087 2:121279540-121279562 AGGGGGTTGCTTCTACCCAGAGG No data
937368074_937368082 8 Left 937368074 2:121279492-121279514 CCCTTGGGGATAAAGCATCACCT No data
Right 937368082 2:121279523-121279545 GGCCCCTCCACAATGAGAGGGGG No data
937368074_937368088 26 Left 937368074 2:121279492-121279514 CCCTTGGGGATAAAGCATCACCT No data
Right 937368088 2:121279541-121279563 GGGGGTTGCTTCTACCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937368074 Original CRISPR AGGTGATGCTTTATCCCCAA GGG (reversed) Intronic