ID: 937368075

View in Genome Browser
Species Human (GRCh38)
Location 2:121279493-121279515
Sequence AAGGTGATGCTTTATCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937368075_937368079 4 Left 937368075 2:121279493-121279515 CCTTGGGGATAAAGCATCACCTT No data
Right 937368079 2:121279520-121279542 TGCGGCCCCTCCACAATGAGAGG No data
937368075_937368088 25 Left 937368075 2:121279493-121279515 CCTTGGGGATAAAGCATCACCTT No data
Right 937368088 2:121279541-121279563 GGGGGTTGCTTCTACCCAGAGGG No data
937368075_937368082 7 Left 937368075 2:121279493-121279515 CCTTGGGGATAAAGCATCACCTT No data
Right 937368082 2:121279523-121279545 GGCCCCTCCACAATGAGAGGGGG No data
937368075_937368087 24 Left 937368075 2:121279493-121279515 CCTTGGGGATAAAGCATCACCTT No data
Right 937368087 2:121279540-121279562 AGGGGGTTGCTTCTACCCAGAGG No data
937368075_937368080 5 Left 937368075 2:121279493-121279515 CCTTGGGGATAAAGCATCACCTT No data
Right 937368080 2:121279521-121279543 GCGGCCCCTCCACAATGAGAGGG No data
937368075_937368089 28 Left 937368075 2:121279493-121279515 CCTTGGGGATAAAGCATCACCTT No data
Right 937368089 2:121279544-121279566 GGTTGCTTCTACCCAGAGGGAGG No data
937368075_937368081 6 Left 937368075 2:121279493-121279515 CCTTGGGGATAAAGCATCACCTT No data
Right 937368081 2:121279522-121279544 CGGCCCCTCCACAATGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937368075 Original CRISPR AAGGTGATGCTTTATCCCCA AGG (reversed) Intronic