ID: 937368076 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:121279502-121279524 |
Sequence | TAAAGCATCACCTTCCACTG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
937368073_937368076 | -1 | Left | 937368073 | 2:121279480-121279502 | CCAGCAGAGCTGCCCTTGGGGAT | No data | ||
Right | 937368076 | 2:121279502-121279524 | TAAAGCATCACCTTCCACTGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
937368076 | Original CRISPR | TAAAGCATCACCTTCCACTG CGG | Intronic | ||