ID: 937368076 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:121279502-121279524 |
| Sequence | TAAAGCATCACCTTCCACTG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 937368073_937368076 | -1 | Left | 937368073 | 2:121279480-121279502 | CCAGCAGAGCTGCCCTTGGGGAT | No data | ||
| Right | 937368076 | 2:121279502-121279524 | TAAAGCATCACCTTCCACTGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 937368076 | Original CRISPR | TAAAGCATCACCTTCCACTG CGG | Intronic | ||