ID: 937368080

View in Genome Browser
Species Human (GRCh38)
Location 2:121279521-121279543
Sequence GCGGCCCCTCCACAATGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937368073_937368080 18 Left 937368073 2:121279480-121279502 CCAGCAGAGCTGCCCTTGGGGAT No data
Right 937368080 2:121279521-121279543 GCGGCCCCTCCACAATGAGAGGG No data
937368075_937368080 5 Left 937368075 2:121279493-121279515 CCTTGGGGATAAAGCATCACCTT No data
Right 937368080 2:121279521-121279543 GCGGCCCCTCCACAATGAGAGGG No data
937368074_937368080 6 Left 937368074 2:121279492-121279514 CCCTTGGGGATAAAGCATCACCT No data
Right 937368080 2:121279521-121279543 GCGGCCCCTCCACAATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937368080 Original CRISPR GCGGCCCCTCCACAATGAGA GGG Intronic