ID: 937368082

View in Genome Browser
Species Human (GRCh38)
Location 2:121279523-121279545
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937368075_937368082 7 Left 937368075 2:121279493-121279515 CCTTGGGGATAAAGCATCACCTT No data
Right 937368082 2:121279523-121279545 GGCCCCTCCACAATGAGAGGGGG No data
937368073_937368082 20 Left 937368073 2:121279480-121279502 CCAGCAGAGCTGCCCTTGGGGAT No data
Right 937368082 2:121279523-121279545 GGCCCCTCCACAATGAGAGGGGG No data
937368074_937368082 8 Left 937368074 2:121279492-121279514 CCCTTGGGGATAAAGCATCACCT No data
Right 937368082 2:121279523-121279545 GGCCCCTCCACAATGAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type