ID: 937368083

View in Genome Browser
Species Human (GRCh38)
Location 2:121279525-121279547
Sequence AACCCCCTCTCATTGTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937368083_937368089 -4 Left 937368083 2:121279525-121279547 CCCCTCCACAATGAGAGGGGGTT No data
Right 937368089 2:121279544-121279566 GGTTGCTTCTACCCAGAGGGAGG No data
937368083_937368087 -8 Left 937368083 2:121279525-121279547 CCCCTCCACAATGAGAGGGGGTT No data
Right 937368087 2:121279540-121279562 AGGGGGTTGCTTCTACCCAGAGG No data
937368083_937368088 -7 Left 937368083 2:121279525-121279547 CCCCTCCACAATGAGAGGGGGTT No data
Right 937368088 2:121279541-121279563 GGGGGTTGCTTCTACCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937368083 Original CRISPR AACCCCCTCTCATTGTGGAG GGG (reversed) Intronic