ID: 937368084

View in Genome Browser
Species Human (GRCh38)
Location 2:121279526-121279548
Sequence CAACCCCCTCTCATTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937368084_937368087 -9 Left 937368084 2:121279526-121279548 CCCTCCACAATGAGAGGGGGTTG No data
Right 937368087 2:121279540-121279562 AGGGGGTTGCTTCTACCCAGAGG No data
937368084_937368089 -5 Left 937368084 2:121279526-121279548 CCCTCCACAATGAGAGGGGGTTG No data
Right 937368089 2:121279544-121279566 GGTTGCTTCTACCCAGAGGGAGG No data
937368084_937368088 -8 Left 937368084 2:121279526-121279548 CCCTCCACAATGAGAGGGGGTTG No data
Right 937368088 2:121279541-121279563 GGGGGTTGCTTCTACCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937368084 Original CRISPR CAACCCCCTCTCATTGTGGA GGG (reversed) Intronic