ID: 937368084 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:121279526-121279548 |
Sequence | CAACCCCCTCTCATTGTGGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 151 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 11, 4: 138} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
937368084_937368087 | -9 | Left | 937368084 | 2:121279526-121279548 | CCCTCCACAATGAGAGGGGGTTG | 0: 1 1: 0 2: 1 3: 11 4: 138 |
||
Right | 937368087 | 2:121279540-121279562 | AGGGGGTTGCTTCTACCCAGAGG | No data | ||||
937368084_937368088 | -8 | Left | 937368084 | 2:121279526-121279548 | CCCTCCACAATGAGAGGGGGTTG | 0: 1 1: 0 2: 1 3: 11 4: 138 |
||
Right | 937368088 | 2:121279541-121279563 | GGGGGTTGCTTCTACCCAGAGGG | No data | ||||
937368084_937368089 | -5 | Left | 937368084 | 2:121279526-121279548 | CCCTCCACAATGAGAGGGGGTTG | 0: 1 1: 0 2: 1 3: 11 4: 138 |
||
Right | 937368089 | 2:121279544-121279566 | GGTTGCTTCTACCCAGAGGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
937368084 | Original CRISPR | CAACCCCCTCTCATTGTGGA GGG (reversed) | Intronic | ||