ID: 937368085 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:121279527-121279549 |
Sequence | GCAACCCCCTCTCATTGTGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
937368085_937368088 | -9 | Left | 937368085 | 2:121279527-121279549 | CCTCCACAATGAGAGGGGGTTGC | No data | ||
Right | 937368088 | 2:121279541-121279563 | GGGGGTTGCTTCTACCCAGAGGG | No data | ||||
937368085_937368089 | -6 | Left | 937368085 | 2:121279527-121279549 | CCTCCACAATGAGAGGGGGTTGC | No data | ||
Right | 937368089 | 2:121279544-121279566 | GGTTGCTTCTACCCAGAGGGAGG | No data | ||||
937368085_937368087 | -10 | Left | 937368085 | 2:121279527-121279549 | CCTCCACAATGAGAGGGGGTTGC | No data | ||
Right | 937368087 | 2:121279540-121279562 | AGGGGGTTGCTTCTACCCAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
937368085 | Original CRISPR | GCAACCCCCTCTCATTGTGG AGG (reversed) | Intronic | ||