ID: 937368088

View in Genome Browser
Species Human (GRCh38)
Location 2:121279541-121279563
Sequence GGGGGTTGCTTCTACCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937368083_937368088 -7 Left 937368083 2:121279525-121279547 CCCCTCCACAATGAGAGGGGGTT No data
Right 937368088 2:121279541-121279563 GGGGGTTGCTTCTACCCAGAGGG No data
937368084_937368088 -8 Left 937368084 2:121279526-121279548 CCCTCCACAATGAGAGGGGGTTG No data
Right 937368088 2:121279541-121279563 GGGGGTTGCTTCTACCCAGAGGG No data
937368075_937368088 25 Left 937368075 2:121279493-121279515 CCTTGGGGATAAAGCATCACCTT No data
Right 937368088 2:121279541-121279563 GGGGGTTGCTTCTACCCAGAGGG No data
937368077_937368088 6 Left 937368077 2:121279512-121279534 CCTTCCACTGCGGCCCCTCCACA No data
Right 937368088 2:121279541-121279563 GGGGGTTGCTTCTACCCAGAGGG No data
937368074_937368088 26 Left 937368074 2:121279492-121279514 CCCTTGGGGATAAAGCATCACCT No data
Right 937368088 2:121279541-121279563 GGGGGTTGCTTCTACCCAGAGGG No data
937368078_937368088 2 Left 937368078 2:121279516-121279538 CCACTGCGGCCCCTCCACAATGA No data
Right 937368088 2:121279541-121279563 GGGGGTTGCTTCTACCCAGAGGG No data
937368085_937368088 -9 Left 937368085 2:121279527-121279549 CCTCCACAATGAGAGGGGGTTGC No data
Right 937368088 2:121279541-121279563 GGGGGTTGCTTCTACCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937368088 Original CRISPR GGGGGTTGCTTCTACCCAGA GGG Intronic