ID: 937369005

View in Genome Browser
Species Human (GRCh38)
Location 2:121284997-121285019
Sequence CTCGGGCCGGGCCGGCGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 6, 3: 65, 4: 503}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937369005_937369020 11 Left 937369005 2:121284997-121285019 CCGGCCCGCCGGCCCGGCCCGAG 0: 1
1: 0
2: 6
3: 65
4: 503
Right 937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
937369005_937369022 21 Left 937369005 2:121284997-121285019 CCGGCCCGCCGGCCCGGCCCGAG 0: 1
1: 0
2: 6
3: 65
4: 503
Right 937369022 2:121285041-121285063 CCCTTACCGCAGGTAGCTGCCGG 0: 1
1: 0
2: 0
3: 6
4: 69
937369005_937369016 -2 Left 937369005 2:121284997-121285019 CCGGCCCGCCGGCCCGGCCCGAG 0: 1
1: 0
2: 6
3: 65
4: 503
Right 937369016 2:121285018-121285040 AGACCCGCGGGGACCGCGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937369005 Original CRISPR CTCGGGCCGGGCCGGCGGGC CGG (reversed) Intronic
900207006 1:1435909-1435931 CTCCGGACGGGCGGGCGGGCTGG + Intronic
900214137 1:1472108-1472130 GGCGGGGCGGGCGGGCGGGCGGG + Intronic
900390434 1:2431608-2431630 CTCTGGCAGGGCCTGGGGGCGGG + Intronic
900513020 1:3069330-3069352 CGGGGCCCGGGCCGCCGGGCCGG + Intronic
900630652 1:3633429-3633451 CCCGGCCCGGGGCGGCGGGAAGG + Exonic
901540191 1:9910393-9910415 CCGGGGCGGGGCCTGCGGGCGGG + Intergenic
901703868 1:11059605-11059627 CTGGGGCTGGGACTGCGGGCTGG - Intronic
901825628 1:11859131-11859153 GCCGGGTCGGGCCGGGGGGCAGG + Intergenic
902072179 1:13749499-13749521 CCGGGGCCGGGCGGGCGGGCCGG - Intronic
902263821 1:15247244-15247266 CACAGGCCGGCCGGGCGGGCGGG + Intergenic
902348746 1:15837560-15837582 GTCGGGCCGGGGCAGCGCGCTGG + Intergenic
902476732 1:16692453-16692475 GGCGCGGCGGGCCGGCGGGCGGG + Intergenic
903060408 1:20664861-20664883 CTCTGGCTGGGCAGGGGGGCGGG - Intronic
903153280 1:21428198-21428220 GCCGGGCCGGGCCGGAGCGCGGG + Intergenic
903184334 1:21620706-21620728 CCCGAGCCGGGCCAGCCGGCAGG - Intronic
903184754 1:21622648-21622670 CGCGGGCCGGGCCGCCCGGGGGG - Intronic
903621683 1:24702705-24702727 CTGGGGCCAGGCCAGCTGGCAGG + Intergenic
903724654 1:25431369-25431391 GTCGGCCCGGCCGGGCGGGCAGG + Intronic
904063025 1:27726037-27726059 GGCGGGCCGGGCCGGCGGGTCGG + Exonic
904063057 1:27726165-27726187 CGCGGGCTGGGGCGGCGGCCGGG + Intronic
904822920 1:33256738-33256760 CGGGGGCCGGGCCGGGGCGCGGG + Intronic
904880988 1:33696726-33696748 CTGGGGCCTGGCAGGTGGGCAGG + Intronic
905440123 1:37990274-37990296 CTGGGGCCGGCTTGGCGGGCAGG + Exonic
905789780 1:40783934-40783956 GCCGGGCCGGGGCCGCGGGCGGG - Intergenic
905912134 1:41662316-41662338 CGCGGGGCGGGCTGGCGGGCGGG + Intronic
906919409 1:50048138-50048160 CTCGGGCCGGATCGCCCGGCGGG + Intronic
907261332 1:53220675-53220697 CCGGGGCCGGGCCGCGGGGCAGG + Intergenic
908738928 1:67307743-67307765 ATCGGGCCGGGGCGGGGGTCGGG - Exonic
910550272 1:88467154-88467176 GCCGGGCCGGGCCGGCCGGTTGG - Intergenic
912401444 1:109397405-109397427 GTCGGGCCCGGGCGGCCGGCGGG - Intronic
912670520 1:111620083-111620105 CGGGGGCCTGGCCGGCGGGAGGG + Intronic
913109238 1:115642445-115642467 CGCGTGCCGGGGCGGCGGGCAGG + Intronic
913680682 1:121185589-121185611 ATCGGGGCGGGCCGGGGGGTGGG - Intronic
914032514 1:143973231-143973253 ATCGGGGCGGGCCGGGGGGTGGG - Intergenic
914156932 1:145094736-145094758 ATCGGGGCGGGCCGGGGGGTGGG + Intronic
915458092 1:156053752-156053774 GCCGGGCCGGCCGGGCGGGCGGG - Exonic
915616967 1:157046161-157046183 CGCGGGCCGGGCCGGGGATCCGG - Intergenic
916130209 1:161606054-161606076 CTCAGCCCGGGCGGGCGGGCGGG + Intronic
917738840 1:177944285-177944307 CACAGGCCGGGGCGGCAGGCAGG + Intronic
917817664 1:178726026-178726048 CTCGGGCCGGGCGCGCGGGCCGG + Intronic
919382679 1:196878129-196878151 CTAGCGCTGGGCGGGCGGGCTGG - Intronic
919896981 1:202015130-202015152 CGCGGGCCAGGTGGGCGGGCTGG + Intronic
920022644 1:202967260-202967282 CGCGGGGCGGGTCGGAGGGCGGG + Exonic
920260396 1:204684752-204684774 CTCCTCCCGGGCCGGCTGGCTGG - Intronic
920451695 1:206064623-206064645 CCCGGGACGGGGCGGCCGGCCGG - Intronic
920467994 1:206204115-206204137 ATCGGGGCGGGCCGGGGGGTGGG - Intronic
920655144 1:207868969-207868991 CTTGGGCCGGGCCTGCAGGGCGG - Intergenic
920805628 1:209231601-209231623 CTCGGCCCGGCCTCGCGGGCGGG - Intergenic
921029705 1:211326772-211326794 CTGGGGCGGGGCCGGGGCGCGGG - Intronic
921189880 1:212699795-212699817 CACGGGCAGGGCGCGCGGGCGGG - Exonic
922758432 1:228109478-228109500 CCCAGGCGGGGCCGGCGAGCAGG + Intergenic
924801525 1:247332024-247332046 CCTGGGCCTGGCCGCCGGGCCGG + Intergenic
1063115124 10:3067482-3067504 CTGGGGCCGGGCGGGGGCGCGGG + Intronic
1064149370 10:12849844-12849866 CTCAGGCCTGAGCGGCGGGCTGG + Intergenic
1064418281 10:15168822-15168844 GCAGGGCGGGGCCGGCGGGCTGG - Intergenic
1064418290 10:15168840-15168862 GCAGGGCGGGGCCGGCGGGCAGG - Intergenic
1065342956 10:24723619-24723641 CTCACGCCGGGCGGGCGGGCGGG - Exonic
1066221154 10:33336651-33336673 CTGCGCCCGGGCAGGCGGGCAGG + Intergenic
1066465144 10:35643428-35643450 GGCGGCCCGGGCCGGCGGCCTGG + Intergenic
1067406720 10:46030352-46030374 CCCGGGCCCGGCGGGCAGGCAGG + Intronic
1067937483 10:50624032-50624054 CTGCGGCCGGGGGGGCGGGCCGG + Intronic
1071997529 10:91162911-91162933 CTCGCGCCCGCCCGCCGGGCCGG + Intergenic
1071997530 10:91162917-91162939 GCTGGGCCGGCCCGGCGGGCGGG - Intergenic
1073088539 10:100912719-100912741 CTCGGCCTTGGCCGGCGCGCGGG - Intronic
1073135307 10:101216939-101216961 CGCGGGCCGGGCAGGCGGTCAGG - Intergenic
1073242464 10:102067245-102067267 GGCGGGCCGGGCTGGGGGGCAGG + Exonic
1074085715 10:110207906-110207928 CTCGGGCAGGGCCGGGGGCTGGG - Exonic
1074095110 10:110304759-110304781 CTGGGGGCGGGGCGGCGGGAAGG + Exonic
1075031931 10:119029711-119029733 CCCGCGGCAGGCCGGCGGGCAGG + Exonic
1076146512 10:128126379-128126401 CTGCGGGCGGGCGGGCGGGCGGG - Exonic
1076379566 10:130015779-130015801 CTGGGGCCAGGCGGGCAGGCTGG + Intergenic
1076603861 10:131676998-131677020 CTGGGGCGGGGCCGGGGGGAGGG - Intergenic
1076690683 10:132222601-132222623 CTCAGGGCGCGGCGGCGGGCTGG - Intronic
1076898538 10:133325799-133325821 CCCGGGCCGGGCTGCGGGGCTGG + Exonic
1077015449 11:397167-397189 CTCCAGCCGGGCAGGGGGGCTGG + Exonic
1077034819 11:489530-489552 CTCGCGACGGCGCGGCGGGCGGG + Intronic
1077053160 11:576713-576735 CGCGGGCCGGGAGGGCGGGCGGG + Intronic
1077074872 11:695796-695818 ATCGCGACGGACCGGCGGGCGGG + Exonic
1077272768 11:1689610-1689632 CTAGGGCATGGCCGGTGGGCAGG - Intergenic
1077328363 11:1973298-1973320 CCAGGGCCGGGCTGGCAGGCGGG + Intronic
1077413647 11:2414677-2414699 CTGGGGCCGGGCCCGCGCGCGGG - Intronic
1077491376 11:2862427-2862449 CGCGGGCCTGGCGGGCGGGGCGG + Intergenic
1077528457 11:3083445-3083467 CTTGGGCTAGGCCGGGGGGCAGG - Intergenic
1078128694 11:8594036-8594058 CTCAGGGCGGGCCCGCGGGATGG - Intronic
1078144819 11:8715557-8715579 CTGGAGCCGGGCAGGTGGGCGGG - Intronic
1078845392 11:15114898-15114920 CTCGGGCTGGGCCGGCAGAGCGG + Intronic
1079451772 11:20604497-20604519 CTCAGGCAGGGCCGCCGGGCGGG + Intronic
1081329683 11:41788333-41788355 CTCGGGCATGGCGGGCTGGCAGG + Intergenic
1081863547 11:46347597-46347619 CCCATGCCGGGCCGGCGGCCGGG - Intronic
1081869239 11:46375826-46375848 GTCGGGCAGGGCCGGCAAGCGGG - Intronic
1081963761 11:47157132-47157154 CTTGGGCGGGGCCGGCACGCTGG + Exonic
1082035561 11:47642617-47642639 CTCGGGGCGGGACGGGGGGGCGG - Exonic
1083120840 11:60510484-60510506 CTCCGGACGGGGCGGCTGGCCGG - Intergenic
1083572959 11:63769577-63769599 CTAGGGCCGGGCCGGGGGTCTGG - Intergenic
1083595720 11:63917507-63917529 CTCCACCCGGGCGGGCGGGCAGG - Intergenic
1083656975 11:64234546-64234568 CTGGGCCCGGGCTGGCGGGCAGG - Exonic
1083733630 11:64667432-64667454 TTCAGCCAGGGCCGGCGGGCTGG - Exonic
1083743515 11:64723100-64723122 GGCGGGGCGGGCGGGCGGGCGGG - Exonic
1083758385 11:64803157-64803179 CGCCGGGCGGGCCGGCAGGCGGG + Exonic
1083922135 11:65786822-65786844 CCCGGGCGGGGCGGCCGGGCGGG - Intergenic
1083940022 11:65890736-65890758 CCTGGGCCGCGGCGGCGGGCGGG + Exonic
1084112511 11:67023274-67023296 GCCGGGCCGGGGCGGCGGACCGG - Intronic
1084214793 11:67641461-67641483 CTCGGGCAGGCAGGGCGGGCGGG - Intergenic
1084491956 11:69483815-69483837 CCCGGGCCGGCCCGGCTGGCGGG + Intergenic
1084888439 11:72224889-72224911 CTGGGGCCGGGCCCGGGGCCCGG - Exonic
1084946661 11:72642392-72642414 CAGCGGCCGGGCCGGCGGGCGGG - Intronic
1087014504 11:93542879-93542901 CTTGGGCCGGGGCGGCCGGGAGG - Intronic
1089895675 11:121928110-121928132 CTCGGGCGGGGGCGGGGGGGTGG - Intergenic
1090194089 11:124800211-124800233 CTCGGGCCGGGCAGTGCGGCGGG - Exonic
1091000918 11:131910515-131910537 CTCGGAGCGAGCGGGCGGGCTGG - Intronic
1202811341 11_KI270721v1_random:28477-28499 CCAGGGCCGGGCTGGCAGGCGGG + Intergenic
1091616186 12:2052887-2052909 GGCGCGCCGGGCGGGCGGGCGGG + Intronic
1091807318 12:3365912-3365934 CCGTGGCGGGGCCGGCGGGCAGG - Intergenic
1092143600 12:6200262-6200284 CCCGGGCGGGGCCGGTGGGGCGG + Intronic
1094536279 12:31324946-31324968 GTCGGGCAGGTCCGGCCGGCAGG - Intronic
1095476281 12:42589915-42589937 CTCGGGCCGCGCCCGGGGGCAGG + Intronic
1096786047 12:54017962-54017984 CCAGGGCCGGGCCGCCGAGCAGG + Intronic
1096803436 12:54126503-54126525 CTTGGGGAGGGCAGGCGGGCCGG - Intergenic
1097222630 12:57460039-57460061 GGCGGGCTGGGCCGGCGGGAGGG + Intergenic
1097490931 12:60269843-60269865 CCCGGGCCGGGGACGCGGGCTGG - Intergenic
1100632299 12:96400610-96400632 CGGGGGCGGGGCCGGCGGCCGGG + Intergenic
1101371848 12:104137939-104137961 AGCGGGCCGGGCCGGGGAGCGGG - Intronic
1101371875 12:104137994-104138016 CTCGGCCCGCGCGGGAGGGCGGG + Intronic
1101493964 12:105236172-105236194 CGGGGGCTGGGCCGGCGGGCAGG - Intronic
1101692412 12:107093988-107094010 AGGGGGCGGGGCCGGCGGGCAGG + Intergenic
1102101587 12:110282034-110282056 CTCCCGCGGGGCCGGCGCGCTGG - Intronic
1102853912 12:116277347-116277369 CCCGGGCCGGCGCTGCGGGCCGG + Intergenic
1102896068 12:116599602-116599624 CTCGGGGAGGGCAGGCAGGCCGG - Intergenic
1103325293 12:120116486-120116508 CCCGTGCGGGGCGGGCGGGCGGG - Intronic
1103698601 12:122835818-122835840 CTCGGGCCGCGGAGGCCGGCGGG - Intronic
1103851604 12:123937136-123937158 CTCGGGCTGGGCCTGCGGCGGGG + Exonic
1103903264 12:124314531-124314553 CTGGGGCCGGCCCGGGGTGCTGG + Exonic
1103918880 12:124389346-124389368 CTCGCGGCGGGCGGGCAGGCGGG + Intronic
1104602448 12:130162666-130162688 CTCGCGCCGGGCCGCTGCGCCGG + Exonic
1104692693 12:130838924-130838946 CTGGGGCGGGGGCTGCGGGCAGG - Intronic
1104859165 12:131915838-131915860 CTAGGGCTGGGCCGCCGGACCGG + Intronic
1106157395 13:27171470-27171492 GCCGGGGCGGGCGGGCGGGCTGG - Intronic
1106340247 13:28820246-28820268 CTCGAGCGGGGGCGGCGGCCTGG + Intergenic
1106517180 13:30465445-30465467 CTCGGGCCGGGCGTTCGGGCGGG - Intronic
1107549116 13:41458274-41458296 CCAGGGCCGGGGCTGCGGGCAGG - Exonic
1107787050 13:43968361-43968383 CCCATGCCGGGCCGGCGGCCGGG - Intergenic
1108542061 13:51453621-51453643 CTCGCGCCGGGGCGGCGCGCCGG - Intronic
1113417341 13:110138493-110138515 CGCGGGGCAGGCGGGCGGGCGGG + Intergenic
1116886894 14:50231167-50231189 CTAGGGGCGGGGCGGCCGGCGGG - Intronic
1116958057 14:50944134-50944156 CCGGGGGCGGGACGGCGGGCCGG - Intronic
1118019469 14:61695882-61695904 CCCAGGGCGGGCAGGCGGGCGGG - Intronic
1118607720 14:67515527-67515549 AGCGGGCCGGGCCGGCGAGCGGG - Intronic
1118725782 14:68628297-68628319 CTCGGGCCGCCCCGGGGCGCGGG + Intronic
1118932421 14:70255042-70255064 CTCAGGCATGGCGGGCGGGCAGG - Intergenic
1120788029 14:88554744-88554766 CGCGGCCCGGGCTGGCGTGCGGG - Intergenic
1121342850 14:93115582-93115604 CTCGGGCCCGCGCGGCGGGAGGG - Intronic
1122114359 14:99520417-99520439 ATCGGGGCTGGTCGGCGGGCAGG - Intronic
1122114399 14:99520539-99520561 ATCGGGGCTGGTCGGCGGGCAGG - Intronic
1122514544 14:102297868-102297890 CACAGGCAGGGCCGGTGGGCCGG - Intronic
1122635465 14:103127646-103127668 CTGGGCCCGGGCCGGCAGGGAGG + Intronic
1122719863 14:103716014-103716036 GCCGGGCCGGGGCGGCGGGGCGG - Intronic
1122817314 14:104320108-104320130 CTCAGGCCAGGCCGAGGGGCTGG - Intergenic
1122968303 14:105142125-105142147 CACGGGCCGTGCCGGCAGCCAGG + Exonic
1122975437 14:105168908-105168930 CGCGCGCCGGGCCGGGGCGCTGG - Intergenic
1123041358 14:105491531-105491553 CTCGCGGAGGGCAGGCGGGCCGG + Intronic
1124142285 15:27088243-27088265 CTCGGGGCGGGCGCGGGGGCGGG + Intronic
1124387856 15:29225006-29225028 CACTGCCCGGGCCGGCGGGCTGG + Intronic
1125300911 15:38252720-38252742 CTCGGTGGGGGCCGGCGGGGGGG - Exonic
1128149750 15:65355536-65355558 CTCGGGCCCGGCCGCCGGGAAGG - Intronic
1128457482 15:67840373-67840395 CTGGGGCCGGGGCGGCGCGGAGG + Intergenic
1128866059 15:71115786-71115808 CTCTGGCCGGCGGGGCGGGCTGG + Intronic
1128987347 15:72231026-72231048 CCCGGGGCCGGCCGGCGCGCCGG + Exonic
1129428498 15:75481505-75481527 CTCCGGACGGGGCGGCTGGCCGG - Intronic
1129710618 15:77818866-77818888 CGCGGGCCGGGCCGTCTGGCGGG - Intronic
1129790934 15:78340258-78340280 CGGGGGCAGGGCCGGCGGGGCGG + Intergenic
1130224598 15:82047149-82047171 GTCGGGGCGGGGCCGCGGGCGGG - Intergenic
1131048776 15:89333230-89333252 CTTGGGCCTGGGCGGAGGGCTGG - Exonic
1131199987 15:90388191-90388213 CTGGGGCGGGGCCTGCGGGGTGG + Intergenic
1131431945 15:92394626-92394648 CTGGGGCCGGAGCGGAGGGCGGG + Intronic
1131438052 15:92438633-92438655 CTGGGGCCAGAGCGGCGGGCAGG + Intronic
1131517621 15:93089340-93089362 CGCGGGCGGGGCCGGCAGGGAGG + Intergenic
1132314374 15:100879662-100879684 CTCCCGCAGGGGCGGCGGGCGGG + Exonic
1132464833 16:72600-72622 GGCGGGCCGGACCGGCGGGCGGG - Exonic
1132499821 16:280367-280389 CACGGGCCGGGCGGGCGGCGGGG + Intronic
1132519714 16:381647-381669 GTGGGGCCGGGGCTGCGGGCGGG - Intronic
1132555395 16:569891-569913 CTCGGGTCGGGCGGGCGGGCGGG + Intronic
1132575246 16:661006-661028 CTGAGGCCGGGCCGGGGGGGGGG - Intronic
1132698376 16:1211900-1211922 CCCTGGCGGGGCAGGCGGGCGGG + Intronic
1132741378 16:1414845-1414867 CTGGGGCGGGGTCTGCGGGCCGG - Intergenic
1132756533 16:1488002-1488024 GCCGGGCCGGGCCGGCTGGGCGG + Intronic
1132843558 16:1990032-1990054 CTCGGGCGGGGCCGGCCGGACGG + Exonic
1132968482 16:2673203-2673225 CTGCGGCCGGGCGGCCGGGCCGG - Intergenic
1133230490 16:4364370-4364392 CTCGGGTGGGGCCGGCAGGCGGG + Exonic
1133270545 16:4609087-4609109 CTGGGGAGGGGGCGGCGGGCAGG + Exonic
1133751992 16:8732897-8732919 CTCCGGACGGGGCGGCTGGCCGG + Intronic
1134134140 16:11668567-11668589 CTCGGGCCGGGCGGGGGCGCCGG + Intronic
1134134205 16:11668713-11668735 CAGGGGCCGCGCCCGCGGGCTGG + Intronic
1135234304 16:20741478-20741500 CCCGGGGTGGGCGGGCGGGCCGG - Intronic
1135328503 16:21542895-21542917 CTGGGGCTGGGCCTGCGTGCTGG + Intergenic
1136141666 16:28292611-28292633 CCCGGGCCAGGCCGGGGGCCGGG + Exonic
1136146646 16:28320309-28320331 GGCGGGCCGCGCCGACGGGCTGG + Exonic
1136338849 16:29628868-29628890 CTGGGGCTGGGCCTGCGTGCTGG + Intergenic
1136891924 16:33976886-33976908 CTGGGCCCGGGCAGGCGGGCGGG - Intergenic
1136927521 16:34388609-34388631 CCAGGGACGGGCGGGCGGGCTGG + Intergenic
1136977053 16:35023197-35023219 CCAGGGACGGGCGGGCGGGCTGG - Exonic
1137237323 16:46626380-46626402 CAGGGGCCGGGCCGGCAGACTGG - Intergenic
1137261152 16:46831053-46831075 CGGGGGCCGGGCGCGCGGGCGGG - Intronic
1137707938 16:50548351-50548373 CGCGGGCCGCGGCGGCGGGCTGG + Exonic
1137926473 16:52546611-52546633 ACCGGGCTGGGCCGGTGGGCCGG - Intronic
1138389115 16:56657638-56657660 CCGGGGCGGGGCCGGGGGGCGGG + Intronic
1138561325 16:57802415-57802437 CTCGGCCCGGCCCGGCCCGCCGG + Exonic
1139448615 16:67013876-67013898 CCCGGCCCGGCCCGGCTGGCAGG - Intergenic
1139511603 16:67431196-67431218 CGGGGGCCGGGCCGGGGAGCGGG - Exonic
1141456422 16:84145239-84145261 CTCGGGACGGACCGGCGCGCTGG - Intergenic
1141561061 16:84867990-84868012 CTCAGGCGGGGCTGGAGGGCTGG + Intronic
1141727570 16:85799787-85799809 GCCGGGCCGGGTCGGGGGGCCGG + Exonic
1142037187 16:87869539-87869561 GGTGGGCGGGGCCGGCGGGCCGG - Intergenic
1142113762 16:88345817-88345839 GTGGGGCCTGGCGGGCGGGCTGG - Intergenic
1203081111 16_KI270728v1_random:1146722-1146744 CTGGGCCCGGGCAGGCGGACGGG + Intergenic
1142727959 17:1830139-1830161 CGGGGGCTGGGCCGGCGGTCCGG + Intronic
1143030362 17:3964139-3964161 GCCGGGCCGGGCCGGGGAGCGGG - Intronic
1143582862 17:7836536-7836558 CTCGGTGGGGGCCGGCAGGCGGG - Intergenic
1144586828 17:16492213-16492235 CCGGGGCGGGGCCGGCGGGCGGG - Intergenic
1144828938 17:18121237-18121259 AGCGAGCGGGGCCGGCGGGCCGG - Exonic
1144967975 17:19089592-19089614 CTCGGGGCGGGCGGGCAGGCCGG + Intergenic
1144979942 17:19162471-19162493 CTCGGGGCGGGCGGGCAGGCCGG - Intergenic
1144988280 17:19215761-19215783 CTCGGGGCGGGCGGGCAGGCCGG + Intronic
1146009189 17:29180224-29180246 CTCCGGCCGGGAGGGAGGGCGGG - Intronic
1146062735 17:29615622-29615644 CTTGGGCTGGGCCCGGGGGCGGG - Exonic
1146126505 17:30235639-30235661 CCCGGGCTGGGCAGGCGGGCTGG + Exonic
1146787446 17:35731995-35732017 CTAGGAGGGGGCCGGCGGGCGGG + Intronic
1147006351 17:37406966-37406988 CGCTGGGCGGGCGGGCGGGCGGG + Intronic
1148206774 17:45784372-45784394 GCCGGGCCGGGCCGCGGGGCCGG + Intronic
1148323683 17:46771640-46771662 CCGGGCCCGGGCCGCCGGGCCGG + Intronic
1148577141 17:48720042-48720064 CTCGGGCGGGGGCGACGGGCTGG + Intergenic
1148818310 17:50346282-50346304 CGACGGCCGGGCGGGCGGGCAGG + Intronic
1149993907 17:61397141-61397163 CTCCGGCCAGGGCGTCGGGCGGG - Intergenic
1150004609 17:61462279-61462301 CTCCTCCCGGGCCGGCGAGCAGG + Intronic
1150423072 17:65056184-65056206 AACGGGCCCGGCGGGCGGGCTGG - Intronic
1151299176 17:73209690-73209712 CCCGGACAGGGCCAGCGGGCCGG - Exonic
1151608301 17:75154148-75154170 CCCGGGTGGGGCCGGCGCGCAGG + Intronic
1151608314 17:75154210-75154232 CTCGCGCCGGGGCGGGTGGCGGG - Intronic
1152388049 17:79986841-79986863 CTGAGGCCGGGCCGGTGGGAGGG + Intronic
1152406638 17:80101660-80101682 CGCGGGCCGGGTCGGTGGGGCGG + Intergenic
1152596159 17:81238810-81238832 CCCGGGACGGCGCGGCGGGCGGG + Intronic
1152654354 17:81513021-81513043 CCCTGCGCGGGCCGGCGGGCGGG + Intronic
1152687889 17:81703592-81703614 GGCGGTCCGGGCCGGCAGGCGGG + Intronic
1152706186 17:81844797-81844819 CCCGGGCCCCGCCAGCGGGCTGG + Intronic
1152708863 17:81860298-81860320 GCCGGGCCTGGCGGGCGGGCGGG - Intronic
1152729060 17:81961037-81961059 CTCCGCCAGGCCCGGCGGGCGGG - Exonic
1152852822 17:82647990-82648012 CTCGGCCCGGGACGGCCGGCTGG + Intronic
1152852885 17:82648144-82648166 CTCGGGCGGGGCCGGGGTCCCGG + Intronic
1154194246 18:12254291-12254313 CGCGGGGCTGGCAGGCGGGCGGG + Intergenic
1157464201 18:47930529-47930551 CCCGGGCCCGGCCGGCGGCCCGG + Exonic
1158505573 18:58044115-58044137 CACAGGCCGGGCTGGCGAGCGGG - Intergenic
1158954763 18:62526838-62526860 CGGGGGCGGGGCCGGCGCGCCGG - Intronic
1160679341 19:405659-405681 CTCAGGCCGGGGAGGCGGGGAGG - Exonic
1160726144 19:618664-618686 CTGGGGCCTGGCCGGGGGTCTGG - Intronic
1160730847 19:641002-641024 CTCGGGCCGGGGCAGAGGCCTGG + Intronic
1160775937 19:855762-855784 CTCGTGAGGGGCCGGCAGGCCGG + Exonic
1160820702 19:1056407-1056429 GGCGGGCCGGGCCTGGGGGCAGG - Exonic
1160952858 19:1675879-1675901 CCCCGCCCGGGCCGGCGGGGAGG - Intergenic
1161215812 19:3094586-3094608 CCAGGGCCGGGCCGGGGGCCGGG + Exonic
1161249004 19:3270602-3270624 CCCGGGGCGGCCGGGCGGGCGGG + Intronic
1161343293 19:3754160-3754182 CCGGGGCCGGGCGGGCAGGCGGG - Intronic
1161560332 19:4969376-4969398 CTTTGTCCGGGCCGGCGGGGCGG + Intronic
1161581737 19:5084859-5084881 GGTGGGCCGGGGCGGCGGGCGGG - Intronic
1161628737 19:5340771-5340793 CGCCGGCCGGGCTGCCGGGCGGG + Exonic
1161779143 19:6279705-6279727 GGCCGGGCGGGCCGGCGGGCGGG + Intronic
1161952818 19:7477222-7477244 GGCGGCCCGGGCCGGCGGCCAGG - Exonic
1161959529 19:7516152-7516174 CGCCGGCGGGGCTGGCGGGCGGG + Exonic
1161959581 19:7516271-7516293 CTGGGGCCGGGGCGGGGGGCTGG + Intronic
1162490384 19:10987804-10987826 CGCGGGCTGGGCCGGCTGCCCGG - Exonic
1162577038 19:11505352-11505374 CAGGAGCCGGGCCGGCGGCCTGG - Intronic
1162783953 19:13022714-13022736 CTCCCGGCGGGCTGGCGGGCGGG - Intronic
1162794876 19:13081834-13081856 CTCGGGCCAGGCCACCGGACAGG + Exonic
1162940498 19:14006190-14006212 CCCGGGCCGGGCCTGGGGGGTGG + Exonic
1162954338 19:14090082-14090104 CGCCGGCGGGGCCGGCGGGGTGG + Exonic
1163329482 19:16627703-16627725 CTCGGGCCCGGGCCGGGGGCAGG - Intronic
1163329569 19:16627964-16627986 TTGCGGCCGGGCCAGCGGGCGGG + Exonic
1163443515 19:17333658-17333680 CACTGGGCGGGCGGGCGGGCGGG + Intronic
1163529534 19:17841684-17841706 CTCCGGCCGGGCCAACGCGCGGG + Exonic
1163575770 19:18110092-18110114 GCCGGGCCGGGCCTGCGCGCAGG + Intronic
1163684163 19:18701193-18701215 CTGGGGGCGGGCCCGCGAGCAGG - Intronic
1164639019 19:29811690-29811712 CGCGGGGCGGGGCGGCGGGCGGG - Intergenic
1164639053 19:29811773-29811795 CAGGGGCGGGGCCGGCGGACAGG - Intergenic
1165225678 19:34352979-34353001 CTCTGGGCGGGCAGGCAGGCAGG - Exonic
1165233871 19:34404864-34404886 GCTGGGGCGGGCCGGCGGGCTGG + Intronic
1165851421 19:38852140-38852162 ACCAGGCCGGGCCGGCGGCCTGG - Intronic
1165928699 19:39342688-39342710 CGCGGGCGGCGGCGGCGGGCGGG + Intronic
1166039045 19:40191430-40191452 CTCGGGCCCCGCCGGTGGCCCGG + Intergenic
1166347765 19:42177008-42177030 CGCGGCGCGGGCGGGCGGGCGGG + Intronic
1166721849 19:45001554-45001576 CGCGGGCCGGCCGGGCGGCCGGG - Exonic
1166734567 19:45076378-45076400 CGCGGGCCGGGCGAGCGAGCGGG + Exonic
1166843258 19:45711695-45711717 CGGGGGCCGGGCCGGCCGGGAGG - Exonic
1166887980 19:45973227-45973249 CTCGGGGCGGGGGAGCGGGCAGG - Intronic
1167101609 19:47407311-47407333 CTCGCCCCGGGCCGGCCCGCGGG + Intronic
1167628191 19:50606194-50606216 CGCGCGGCGGGCCCGCGGGCTGG + Intergenic
1167880244 19:52451515-52451537 CGCGGGCTGGGCCCGCTGGCTGG - Intronic
1168076382 19:53982725-53982747 CGCGGGCGGGGCGGGCGGCCCGG - Exonic
1168247040 19:55117601-55117623 CCCGGGGCGGGCGGGCGGGCGGG - Intergenic
1168295750 19:55376759-55376781 CTGGGGCCTGGCGGGCAGGCGGG + Intergenic
924987897 2:288136-288158 GAGGGGCCGGGCTGGCGGGCGGG - Exonic
926724165 2:15984522-15984544 CCACGGCCGGGCAGGCGGGCGGG - Intergenic
927497284 2:23559428-23559450 CTGGGGGCGGGCAGGCAGGCAGG + Intronic
927705735 2:25295286-25295308 CTGGGCCAGGGCCTGCGGGCTGG - Intronic
929107165 2:38376855-38376877 CACGCGGCGGGCTGGCGGGCAGG + Intronic
929188694 2:39120705-39120727 CCGGGGCGGCGCCGGCGGGCCGG - Intronic
929511464 2:42568718-42568740 CTCGGGCTCCGCGGGCGGGCGGG + Intronic
929604752 2:43226808-43226830 TCCGGGCGGGGCCGGCGGCCCGG + Intergenic
929681288 2:43995798-43995820 CTCGCGCCGGGCCCGTGGCCGGG - Exonic
929739607 2:44588446-44588468 CTCCGGACGGGGCGGCTGGCCGG - Intronic
929780753 2:44955470-44955492 CTCACGCCGGGCCAGCGGGGAGG + Intergenic
930136045 2:47905411-47905433 GCCGGGGCGGGCGGGCGGGCGGG - Intronic
930529601 2:52572720-52572742 CTCAGCCCGGGCCGGCGAGTGGG - Intergenic
930665490 2:54095883-54095905 CTCCGGACGGGGCGGCTGGCCGG + Intronic
931602537 2:64019039-64019061 CTCGGGCCCGGCCGGGCGCCGGG - Exonic
931711144 2:64989684-64989706 CTCAGGCGGGGCCTGCGGCCGGG + Exonic
934688062 2:96335906-96335928 GGCGGGCAGGGCTGGCGGGCTGG + Intronic
934966886 2:98731183-98731205 GTCGGGGCGGCCCGGCGGGGCGG - Intergenic
935622896 2:105144296-105144318 CTCGGGCGGTGCCGGCGCGCGGG + Intergenic
936104509 2:109613703-109613725 CCCGGGCCGGACCAGGGGGCCGG + Intronic
936512125 2:113157237-113157259 GCCGGGCTGGGCCGCCGGGCAGG - Intergenic
937369005 2:121284997-121285019 CTCGGGCCGGGCCGGCGGGCCGG - Intronic
937950937 2:127387648-127387670 CCCGGGCCGGGCGGGGTGGCGGG + Intronic
937993126 2:127675102-127675124 CGCGGCCCGGGCTGGCGGGCGGG - Intronic
938073101 2:128318645-128318667 GCCGGGCCGGGCCGGAGCGCGGG - Intergenic
939178649 2:138780387-138780409 CTCTGGCCGGGTGGGCGGGCAGG + Intergenic
941603001 2:167563631-167563653 CTCGGGACGGGGCGGCTGGCCGG + Intergenic
942630514 2:177946476-177946498 CCCGGGACGGGGCGGCTGGCCGG - Intronic
942653742 2:178194376-178194398 CTCCAGCCGGGCGGACGGGCGGG + Intergenic
943646051 2:190408566-190408588 CACGGGCCCAGCCGGAGGGCGGG + Intronic
945080925 2:206085669-206085691 CGCGGGCGGCGACGGCGGGCGGG - Intronic
945245256 2:207711710-207711732 CCGGGGCCGGGCCGCGGGGCGGG + Intronic
946391374 2:219418639-219418661 GTCGGGCGGGGCCGGGGGCCTGG + Exonic
946395493 2:219442020-219442042 AGGGGGCCGGGCCGGCGGCCGGG - Intronic
946689997 2:222302537-222302559 CTGGGGCCGGGCGGGTGGCCAGG - Intronic
947592985 2:231395729-231395751 CACGGCTCGGGCCGGCGGGACGG - Exonic
948858521 2:240741812-240741834 CTCGGGCCAGGCCTGGGTGCTGG - Intronic
948864484 2:240768397-240768419 CGCGTGCTGGGCCGGCGGCCTGG + Intronic
948901976 2:240960696-240960718 CAGAGGCCGGGCCGGCCGGCAGG + Intronic
1169065482 20:2692619-2692641 CCCGGGCCGCGGCGGCGGGGCGG - Intergenic
1169262620 20:4149259-4149281 CTCGGCCCGGGCCGGGCGCCGGG + Intronic
1169915006 20:10674846-10674868 CTGCGGCCGGGGCGTCGGGCCGG - Intergenic
1170999271 20:21396832-21396854 CTGGGGCCGAGCGGGCGCGCGGG - Intronic
1172015558 20:31870601-31870623 CTCGGGTCGCGGCGGGGGGCCGG + Exonic
1172118010 20:32583419-32583441 CGCGGGGCGGGCGGGCCGGCCGG + Intronic
1172656460 20:36541422-36541444 CGCGGGGCGGGGCCGCGGGCGGG - Intergenic
1172775214 20:37403222-37403244 CTCGGGACACTCCGGCGGGCAGG - Exonic
1173279796 20:41618158-41618180 TCCGAGCGGGGCCGGCGGGCGGG - Intronic
1173649132 20:44651800-44651822 CGCGATCCAGGCCGGCGGGCGGG - Intronic
1173868562 20:46328365-46328387 CCCAGGGCGGGCCGGCAGGCGGG - Intergenic
1173939118 20:46894939-46894961 CGCGGTGCGGGCGGGCGGGCGGG - Exonic
1174204304 20:48827936-48827958 GACGGGGCGCGCCGGCGGGCCGG + Intergenic
1176016872 20:62938303-62938325 GCCGGGCCGGGCGGGCAGGCGGG + Intronic
1176161868 20:63652538-63652560 CGCGGGACGGGCCGGGAGGCCGG + Intronic
1176198020 20:63846530-63846552 CTGGAGCCGGGCCGGCGGGCCGG + Intergenic
1176223620 20:63981651-63981673 GGCGGGGCGGGCGGGCGGGCGGG - Intronic
1176566745 21:8392040-8392062 CCCGGGCGGGGCGGGCGCGCCGG + Intergenic
1176952535 21:15064534-15064556 GGGGGGCCGGGGCGGCGGGCCGG - Intronic
1178074166 21:29000278-29000300 CCCGGGCCGGCGGGGCGGGCAGG - Intergenic
1178334589 21:31732026-31732048 CACTGGCCCGGCCGGCGAGCGGG + Exonic
1179466824 21:41581430-41581452 CTGGGTCCTGGGCGGCGGGCGGG - Intergenic
1179535732 21:42050229-42050251 CACGGGCGGGGCCGGCTGCCTGG - Intergenic
1180075496 21:45459536-45459558 CTCGAGGTGGGCCGGCGGGGTGG - Intronic
1180161769 21:46001435-46001457 CGCGGGCAGGGGCGGCCGGCAGG - Intronic
1180791485 22:18577709-18577731 CGGGGGCCGGGGCCGCGGGCTGG - Intergenic
1180840891 22:18958359-18958381 AAAGGGCCGGGCCGGCGAGCAGG - Intergenic
1180949478 22:19714716-19714738 GCGGGTCCGGGCCGGCGGGCGGG - Intronic
1181026653 22:20131222-20131244 ATCGGGCAGGGCCGGGGCGCCGG + Intronic
1181026863 22:20131862-20131884 CCGGGGTCGGGCGGGCGGGCTGG - Intronic
1181060599 22:20280415-20280437 AAAGGGCCGGGCCGGCGAGCAGG + Intronic
1181230254 22:21417602-21417624 CGGGGGCCGGGGCCGCGGGCTGG + Intronic
1181248396 22:21517261-21517283 CGGGGGCCGGGGCCGCGGGCTGG - Intergenic
1182222964 22:28773059-28773081 CGCAGGGCGGGCGGGCGGGCGGG + Intronic
1182237126 22:28884205-28884227 CTGCGGGCGGGCAGGCGGGCGGG + Intronic
1182338037 22:29598284-29598306 CCCGGGGCTTGCCGGCGGGCCGG + Intergenic
1182355546 22:29720871-29720893 CTCCGGCCGGGCCGGCGCTGGGG - Intronic
1182547551 22:31084871-31084893 CGGGGGCCGGGCCGGCGCGCGGG - Intronic
1182663909 22:31944030-31944052 CTCGGGGCGGGCGGGACGGCTGG + Intronic
1183665686 22:39244542-39244564 CCCGGGCCGGGTAGGGGGGCGGG + Exonic
1183780241 22:39994861-39994883 CGCGGGCGTGGCCGTCGGGCGGG - Intergenic
1183856080 22:40636248-40636270 CCCGGGCCGGGCCGGGCGGGCGG - Intronic
1184039347 22:41933899-41933921 CTCGGTACGGGCTGGCAGGCTGG - Intergenic
1184412220 22:44331852-44331874 CTCGGGGCCGGCGGGCGGCCGGG - Intergenic
1184663474 22:45976112-45976134 CTCGGGATGGGCCGTGGGGCCGG - Intronic
1184663750 22:45977041-45977063 CCCGGGCGCGGCTGGCGGGCGGG + Exonic
1184681018 22:46072089-46072111 GCAGGGCCGGGCCGTCGGGCGGG - Intronic
1184698066 22:46150657-46150679 CCGGGGGCGGGCGGGCGGGCGGG + Intronic
1184729427 22:46364691-46364713 CTCTGGTCGGGCCAGCCGGCCGG + Exonic
1184759409 22:46536475-46536497 CCCGGGCGGGGCCGGCGCGACGG - Exonic
1185095731 22:48804998-48805020 CCTGGGCAGGGCGGGCGGGCTGG + Intronic
1185333363 22:50261357-50261379 CGCGGGCCGGGCGGGGCGGCCGG - Intronic
1185381293 22:50508467-50508489 CGCGGGGTGGGCCGGCGGGTGGG + Intronic
950282443 3:11719592-11719614 CGCGGACCGGGCCGGCGGACGGG + Intronic
950683773 3:14602579-14602601 CACCGGCCCGGCCGGCGGGTCGG - Intergenic
950710582 3:14810644-14810666 CCGGGGCGGGGCCGCCGGGCGGG - Intergenic
950718876 3:14868407-14868429 CTCTTGCCGGGCCGGCTGACCGG + Intronic
954367704 3:50155172-50155194 CCCGGGCCGGGCGGCCGCGCTGG - Exonic
954384204 3:50236005-50236027 CTCGGGCCTGGGCTGCAGGCGGG - Exonic
954632878 3:52056516-52056538 GGAGGGCCGGGCGGGCGGGCGGG - Exonic
954764018 3:52897689-52897711 CTCCGGCCGGGCCACGGGGCGGG + Intergenic
956678315 3:71754823-71754845 CGCGGCCCGGCCCTGCGGGCCGG - Exonic
958034036 3:88149607-88149629 CGGGGGCCCGGCCAGCGGGCGGG + Intronic
959419367 3:106111903-106111925 CTCCGGACGGGGCGGCTGGCCGG + Intergenic
960925924 3:122795025-122795047 CCCGAGCCGGGCCGGCGGGGAGG - Exonic
961446422 3:126983612-126983634 GGCGGGCCCGGCCGGGGGGCGGG - Intergenic
961750442 3:129091072-129091094 CAGGGGCCGGGCCGGCAGACTGG - Exonic
961780075 3:129316039-129316061 CTGGGGCCGGGCGGCAGGGCTGG + Exonic
962063281 3:131952589-131952611 CTCCGGACGGGGCGGCTGGCCGG - Intronic
962218848 3:133546293-133546315 AGCGGGCCGGGCTGGCGGGTCGG - Intergenic
965590327 3:170356738-170356760 ATCGGGCCGGGCGGGAGGGGTGG - Intergenic
966015350 3:175132452-175132474 CTCCGGACGGGGCGGCTGGCTGG + Intronic
968514876 4:1011780-1011802 CTCGGGCCGGGTCGGGGTCCGGG - Intronic
968515137 4:1012542-1012564 CTCGGGCGGCGGCGGCCGGCGGG - Exonic
968616318 4:1579249-1579271 CGCGGGCGGGGCCGGGGGCCGGG - Intergenic
968659585 4:1793561-1793583 AGCGGGCCGGGCCGGGGCGCGGG + Intronic
968973774 4:3810605-3810627 CTCAGGCAGGGACGGTGGGCAGG - Intergenic
969603268 4:8189391-8189413 GGCTGGCCGGGCCGGCGGCCGGG + Intronic
969617459 4:8262044-8262066 CCAGGGCCAGGCCTGCGGGCAGG + Intergenic
973758959 4:54100143-54100165 CCCGAGCCGGGGCGCCGGGCGGG + Exonic
976146111 4:82044158-82044180 CACGGCCCCGGCTGGCGGGCGGG - Intronic
978605669 4:110476546-110476568 CTCCAGCGGGGACGGCGGGCCGG + Exonic
981923464 4:150112815-150112837 CTCTGTCCGGGGCGGGGGGCGGG - Intronic
982203976 4:152983342-152983364 CTGGGGCCAGGCAGGCCGGCCGG + Intergenic
984803755 4:183735864-183735886 CCCGGCCCGGGGCGGCCGGCCGG + Intergenic
984852820 4:184168783-184168805 CCCGGGCAGGGCCGGCGGGCAGG + Intronic
984928392 4:184826113-184826135 CGGGGGCGGGGCCTGCGGGCGGG - Intronic
985549186 5:524558-524580 CGCGGGCGGGGCGGGCGTGCCGG - Intergenic
985550139 5:528660-528682 CGCGGGGCGGGGCGGCGGCCGGG - Intergenic
985896297 5:2751564-2751586 CGCGGGCCGGGGCGGCGGCGGGG + Exonic
985896314 5:2751629-2751651 CGCGCGCCAGGCCGGCGGTCGGG + Exonic
986330626 5:6713940-6713962 GTCGGGGCGGGCGGGCGCGCGGG + Intergenic
986993273 5:13578614-13578636 CACTGCCCGGGCCGGCGGGGCGG - Intergenic
987258301 5:16179594-16179616 CTCCTGCCGGCCCGGCTGGCGGG + Exonic
988796290 5:34656293-34656315 CCCGGGCTAGGCCGGCGGGGCGG - Intronic
988941365 5:36151549-36151571 CTCTCACCTGGCCGGCGGGCTGG + Exonic
992124351 5:73625975-73625997 GTCGGGCGCGGCCGGCGGGCGGG + Intergenic
992365496 5:76084871-76084893 CACGGCCTGGGCTGGCGGGCAGG + Intronic
994175123 5:96702728-96702750 CCGGGGCGGGGCCGCCGGGCAGG + Intronic
994366966 5:98928303-98928325 CCGGGGCAGGGCCGCCGGGCCGG + Intronic
995047866 5:107670950-107670972 CTCGGGCGGCGGCGGCAGGCCGG + Intergenic
995052730 5:107724759-107724781 CGGGGGCCGGGGCTGCGGGCAGG - Intergenic
997210434 5:132073878-132073900 CTGGGGCTGGGCGAGCGGGCGGG - Exonic
999322581 5:150624680-150624702 CGCTGGGCGGGCGGGCGGGCGGG - Intronic
1000071356 5:157743796-157743818 CGCGGGCTGGGCGGGCGCGCGGG - Exonic
1001496076 5:172188376-172188398 GTGGAGCCGGGCCGGTGGGCGGG - Exonic
1001556502 5:172641046-172641068 CCCGGGCCGGGAAGGCGCGCAGG - Intergenic
1001581276 5:172800204-172800226 CTCAGCCCGGGTCAGCGGGCTGG - Intergenic
1001641361 5:173246253-173246275 CTCCGGCGGGGCCGGAGTGCAGG + Intergenic
1002044011 5:176532148-176532170 CTCATCCCGGGCAGGCGGGCTGG + Exonic
1002193849 5:177491941-177491963 GCCGGGCAGGGCGGGCGGGCAGG + Intronic
1002277531 5:178113656-178113678 CTCGGGCCGGGACTGCGTGCCGG - Exonic
1002512681 5:179733077-179733099 CACGGGCCGGGCCCGGGGCCGGG - Exonic
1002591009 5:180291788-180291810 CTCGGGCCGGGCCCGCGGGGAGG - Intronic
1002638499 5:180619592-180619614 CTCGGGGTGGGCCGGTGGGACGG - Intronic
1003115828 6:3283430-3283452 CTCGGGGAGGGCCGGGGGGTAGG + Intronic
1003551965 6:7108249-7108271 CTCGGGCCGGCGGGGCGGCCAGG + Intronic
1003868679 6:10384860-10384882 CGCGCGCCGGGCCGGGGCGCGGG + Intergenic
1003874000 6:10421321-10421343 CTCGGCCCGGCCCGTCCGGCTGG - Intergenic
1004217610 6:13717006-13717028 CTCGGGCATGGCGGGCTGGCAGG - Intergenic
1004690232 6:17987301-17987323 CGCGGCCGGGGCCGGGGGGCCGG - Intronic
1004908510 6:20259670-20259692 CCCGGGCCGGCGGGGCGGGCCGG - Intergenic
1004908513 6:20259675-20259697 CACTGCCCGGGCCGGCGGGGCGG - Intergenic
1004923857 6:20401514-20401536 GTAGCGCCGGCCCGGCGGGCGGG + Intergenic
1004923859 6:20401518-20401540 CGCCGGCCCGGCGGGCGGGCGGG + Intergenic
1006372258 6:33652372-33652394 CTCGGGGTGGGCAGGCTGGCAGG - Intronic
1006694607 6:35920730-35920752 CTCAGGCCGGGTCAGGGGGCGGG + Intronic
1011128778 6:84033848-84033870 CCAGGGCCGAGCCCGCGGGCCGG + Exonic
1011628353 6:89301738-89301760 CTGCGGACGGGCAGGCGGGCTGG - Intronic
1011643045 6:89433126-89433148 GTGGGGCGGGGCCGGCGGGACGG + Intergenic
1015149341 6:130020218-130020240 CTCGCGCCGCGGCGGCGGGGCGG + Intronic
1015750043 6:136550274-136550296 GGCGAGCGGGGCCGGCGGGCTGG - Intronic
1015910192 6:138161880-138161902 GGCGGGGCGGGGCGGCGGGCGGG + Intergenic
1017523981 6:155226663-155226685 CTCGGGTGGGGGCGGGGGGCAGG + Intronic
1017808520 6:157967067-157967089 CTGGGGCCTGGCCGACAGGCTGG + Intergenic
1017880610 6:158560239-158560261 CCCCGGCCGAGCGGGCGGGCTGG + Intronic
1018331058 6:162727776-162727798 CTAGGGCCGGGCGCGGGGGCGGG - Intronic
1018400598 6:163415497-163415519 CTTGCGGCGGGCGGGCGGGCCGG + Intronic
1019112110 6:169724542-169724564 GCCGGGGCGGGCCGGAGGGCGGG - Intronic
1019279465 7:192744-192766 CAGGCGCCGGGCGGGCGGGCGGG - Intergenic
1019475518 7:1242366-1242388 CTCGGCCGGGGCGGGCGAGCTGG - Intergenic
1019476457 7:1246897-1246919 CTCGGGGCGGCCCGGCTGCCAGG - Intergenic
1019765155 7:2844334-2844356 CTCGGGCCCGGCGGAGGGGCGGG + Intergenic
1020011780 7:4809237-4809259 CTCGGGCCTGGCCGCCAAGCTGG + Intronic
1020234995 7:6348532-6348554 CTCGGGGAGGGCCGGGGGCCGGG + Intronic
1020270269 7:6590499-6590521 CCCGGGCCCCGCAGGCGGGCGGG + Intronic
1022005522 7:26262368-26262390 CTCCGGACGGGGCGGCTGGCCGG - Intergenic
1022094500 7:27130383-27130405 CTCGGGCTGGGGCGGCCGCCCGG + Exonic
1022102306 7:27175738-27175760 CTGGGGCCGGAGGGGCGGGCAGG - Intronic
1022739782 7:33109599-33109621 CTCGGGCCCAGCCGCCAGGCGGG + Intergenic
1023435263 7:40135071-40135093 CTCCGGCCGGGGCGGCGGGAGGG + Exonic
1024920187 7:54546431-54546453 CGCGGGGCGGGACGGCAGGCGGG + Intronic
1026471118 7:70694630-70694652 CGCGTCCCGGGCCGGCCGGCGGG - Intronic
1026471245 7:70695128-70695150 CGGCGGCCGGGCCGGCGGGCAGG + Intronic
1027233024 7:76282884-76282906 CCCGGACCGGGCCGACGGGGCGG + Intronic
1028193193 7:87876001-87876023 CTCTGGCCGGGCCCGGGGCCGGG - Intronic
1029273850 7:99392884-99392906 CGGGAGCCGGGCCGGCGGGTGGG + Intronic
1029547407 7:101217519-101217541 GGCGGCTCGGGCCGGCGGGCGGG + Exonic
1029569264 7:101359362-101359384 CTCCGGACGGGGCGGCTGGCCGG + Intergenic
1029640472 7:101816571-101816593 CGCGGGGCGAGCGGGCGGGCGGG - Intronic
1031833918 7:126659031-126659053 CTGGGGGCGGGGCGGGGGGCGGG - Intronic
1031899230 7:127392066-127392088 CTTAGGGCGGGCCGGCGGGCGGG + Intronic
1032174396 7:129611893-129611915 TGCGGGGCGGGCCGGCCGGCCGG - Intronic
1033222875 7:139540274-139540296 CTCGGGCTGGGGGGGCGGGCAGG + Intronic
1033390597 7:140924435-140924457 CTCGGGCCAGCTCCGCGGGCTGG - Intronic
1033477133 7:141702039-141702061 CTGGGGCCGGGGCGGCGGCGGGG - Exonic
1034445986 7:151114695-151114717 CCCGGGCCGGGGCCGCGGCCGGG - Intronic
1034448114 7:151123657-151123679 GTCGGGCCGGGGCGGCGGGACGG - Intronic
1036910443 8:12754278-12754300 CTCGGGCCGGGCCCGCCGCGGGG - Intronic
1037805630 8:22056793-22056815 CTGGGGGCGGGAGGGCGGGCGGG - Intronic
1037878643 8:22561894-22561916 GCCGGGCCGGGCCTGTGGGCAGG - Exonic
1038807999 8:30812484-30812506 CCCGGGCCGGGGCCGGGGGCGGG - Exonic
1039527902 8:38232193-38232215 CTCGCGCGGGCCCGGCGGGACGG - Intronic
1039979126 8:42391808-42391830 CTCGGGGAGGGGCGGCGCGCAGG + Intronic
1040495416 8:47961090-47961112 CTCGGGCCGGGCCCGCCTCCCGG - Exonic
1042591494 8:70402774-70402796 CTGGGGCCGGGGCCGGGGGCGGG - Intronic
1044430599 8:92102821-92102843 GTAGGGCTTGGCCGGCGGGCGGG - Intronic
1044660697 8:94590968-94590990 CTCTGGACGGGGCGGCTGGCCGG - Intergenic
1044997325 8:97849811-97849833 CCGGGGGCGGGCAGGCGGGCAGG - Intronic
1045063532 8:98427192-98427214 CGCCCGGCGGGCCGGCGGGCGGG - Exonic
1045277483 8:100721320-100721342 CTCGGGCGGCGGCGGCGGGCGGG - Intronic
1045298654 8:100892628-100892650 CCCGGACCGGGGCGGCTGGCCGG + Intergenic
1045510698 8:102810402-102810424 CCCGGCCTGGGACGGCGGGCGGG - Intergenic
1045743352 8:105387552-105387574 GGCGGGCGGGGCCGGCTGGCTGG + Intronic
1047319813 8:123768675-123768697 CGCGGCCAGGGCCGGCGGCCGGG - Exonic
1047847928 8:128826127-128826149 CTCCGGACGGGGCGGCTGGCCGG + Intergenic
1047998585 8:130358607-130358629 CCCGCGGCGGGCGGGCGGGCGGG + Intronic
1049004766 8:139847682-139847704 CACAGGCCGGGCCGTCGGGAAGG - Intronic
1049238599 8:141525252-141525274 CTGGGGCCGGGGCGGCGGGAAGG + Intergenic
1049406303 8:142453114-142453136 ACCGGGCCGGGCCGGCGAGGGGG - Intronic
1049419651 8:142511080-142511102 CCCCGGCCGGGCCGGCGGGAGGG + Intronic
1049460861 8:142727122-142727144 CGCGGGCCTGGACGGCGGGACGG + Intergenic
1049645484 8:143733929-143733951 CGCGGGCCGGGGGCGCGGGCTGG - Intergenic
1049709786 8:144058305-144058327 CTCGGGCCCGGCCGGCGGCGTGG - Exonic
1049780897 8:144428462-144428484 CCGGGGCCCGGCCGGTGGGCGGG - Intronic
1049936467 9:505083-505105 TTCGGGCCGGGCCGGCCGGCGGG + Intronic
1052362232 9:27573498-27573520 GTCGGGGCGGGCCCGGGGGCGGG - Intronic
1052837826 9:33264755-33264777 CGAGGGCGGGGCCGGCAGGCCGG - Exonic
1053430520 9:38039034-38039056 ATCAGGCAGGGCTGGCGGGCGGG + Intronic
1055757323 9:79570985-79571007 CTGGGGCCGGGGCCGCGGGGTGG - Intergenic
1056992339 9:91423711-91423733 CTCGGGCCGGGCCGGGCCTCCGG + Exonic
1057259683 9:93576700-93576722 TCCGGGCCGGGCCGGGGGCCGGG - Exonic
1057294654 9:93828068-93828090 CCCAGGGCGGGCGGGCGGGCAGG + Intergenic
1057772935 9:97983730-97983752 CTCGGACGGGGAAGGCGGGCGGG + Intronic
1057801269 9:98192676-98192698 GGCGGGCGGGGCCGGAGGGCGGG + Intergenic
1057869738 9:98708788-98708810 CTTGGCGCGGGGCGGCGGGCCGG - Exonic
1058687209 9:107489496-107489518 CTGTGGCCGGGGCGGTGGGCGGG + Exonic
1059102335 9:111483345-111483367 CCCGGGCCTGGCGGACGGGCGGG - Intronic
1059145702 9:111897190-111897212 GCCGGGCCGGTCCGGCGGGCCGG + Exonic
1059208257 9:112486788-112486810 CCGGGGCGGGGCCGGCGAGCGGG - Intronic
1060296503 9:122347050-122347072 CGCGGCCCGGCCGGGCGGGCAGG + Intergenic
1060770151 9:126326738-126326760 CGCGGGCCGCGGCGGCGGGCCGG - Intergenic
1061248417 9:129413376-129413398 CGGGGGCCGGGGCGGGGGGCAGG - Intergenic
1061330675 9:129890358-129890380 CCCGGGCTGGGCGGGAGGGCAGG + Exonic
1061415451 9:130444846-130444868 CGGGGGCCGGGCCCGGGGGCGGG + Intergenic
1061680738 9:132241389-132241411 CCGGGGCCGGGCCGAGGGGCGGG + Intronic
1061990539 9:134156339-134156361 CTCAGGCCTGGCTGGAGGGCAGG + Intronic
1062283960 9:135764909-135764931 CTGGGGCAGGGCCGGCCGGGGGG - Intronic
1062311156 9:135938173-135938195 CTCGGGTCGGGGAGGCTGGCTGG - Intronic
1062364756 9:136203319-136203341 CTCGGGCCGGGCACGCGGGGCGG - Intronic
1062493687 9:136821736-136821758 CACAGGCCGGGCCGCCGGGCTGG + Intronic
1062574539 9:137200169-137200191 CCCGGGCGCGGCGGGCGGGCTGG + Exonic
1062583883 9:137240464-137240486 CGAGGGCCGGGGCGGAGGGCAGG - Intergenic
1062596234 9:137301135-137301157 CGCGTCCCGGGCCTGCGGGCGGG + Exonic
1187443913 X:19344136-19344158 CTGAGGCGGGGCCGGAGGGCAGG + Intronic
1188363714 X:29288304-29288326 CTGGGGCTGGGCAGGTGGGCTGG - Intronic
1189446661 X:41086265-41086287 CCCGGGCTGGGCGGGCGCGCGGG + Intronic
1190274467 X:48891398-48891420 CTGGGGCGGGGCTGGGGGGCCGG - Intergenic
1190745882 X:53321423-53321445 CGGGGGGCGGGCCGGCGGCCGGG - Intergenic
1192361712 X:70445016-70445038 CTGGGGCCGGGCGGGCGTCCCGG - Exonic
1195156037 X:102125669-102125691 CGCTGGGCGGGCTGGCGGGCGGG - Exonic
1196808019 X:119605892-119605914 CTCGGGCGGGGGCGGCGGGAGGG + Intronic
1197746008 X:129932490-129932512 GGCCGGCCGGGCTGGCGGGCAGG - Intergenic
1197893728 X:131289347-131289369 GTTGGGGCGGGCCGGCAGGCGGG - Exonic
1200093573 X:153647123-153647145 CGGGGGCGGGCCCGGCGGGCCGG - Intronic
1200100784 X:153688419-153688441 CGGGGGACGGGGCGGCGGGCGGG - Exonic
1200101126 X:153689421-153689443 CTGGGCCCGGGCGGGCGGGCGGG - Intronic
1200147731 X:153935157-153935179 CGCGGGGCGGGCCTGGGGGCGGG + Exonic
1200235535 X:154466182-154466204 CACGGGCCCCGGCGGCGGGCTGG - Exonic