ID: 937369020

View in Genome Browser
Species Human (GRCh38)
Location 2:121285031-121285053
Sequence CCGCGCGCGGCCCTTACCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937369013_937369020 -2 Left 937369013 2:121285010-121285032 CCGGCCCGAGACCCGCGGGGACC 0: 1
1: 0
2: 0
3: 30
4: 122
Right 937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
937369004_937369020 12 Left 937369004 2:121284996-121285018 CCCGGCCCGCCGGCCCGGCCCGA 0: 1
1: 0
2: 4
3: 50
4: 557
Right 937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
937369007_937369020 6 Left 937369007 2:121285002-121285024 CCGCCGGCCCGGCCCGAGACCCG 0: 1
1: 0
2: 1
3: 18
4: 334
Right 937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
937368999_937369020 30 Left 937368999 2:121284978-121285000 CCTGGACGTCCAACGGCGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
937369015_937369020 -7 Left 937369015 2:121285015-121285037 CCGAGACCCGCGGGGACCGCGCG 0: 1
1: 0
2: 1
3: 7
4: 85
Right 937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
937369002_937369020 21 Left 937369002 2:121284987-121285009 CCAACGGCGCCCGGCCCGCCGGC 0: 1
1: 0
2: 1
3: 34
4: 245
Right 937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
937369014_937369020 -6 Left 937369014 2:121285014-121285036 CCCGAGACCCGCGGGGACCGCGC 0: 1
1: 0
2: 0
3: 15
4: 104
Right 937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
937369005_937369020 11 Left 937369005 2:121284997-121285019 CCGGCCCGCCGGCCCGGCCCGAG 0: 1
1: 0
2: 6
3: 65
4: 503
Right 937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
937369006_937369020 7 Left 937369006 2:121285001-121285023 CCCGCCGGCCCGGCCCGAGACCC 0: 1
1: 0
2: 2
3: 43
4: 353
Right 937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
937369012_937369020 -1 Left 937369012 2:121285009-121285031 CCCGGCCCGAGACCCGCGGGGAC 0: 1
1: 0
2: 1
3: 25
4: 132
Right 937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
937369008_937369020 3 Left 937369008 2:121285005-121285027 CCGGCCCGGCCCGAGACCCGCGG 0: 1
1: 1
2: 3
3: 33
4: 252
Right 937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937369020 Original CRISPR CCGCGCGCGGCCCTTACCGC AGG Exonic
900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG + Intronic
901022056 1:6260686-6260708 CCACGAGCGGCGCTTAGCGCTGG - Intronic
901086368 1:6614268-6614290 CCGCGCTCGGTCCTCTCCGCCGG + Intronic
902478836 1:16701310-16701332 CCGCGCGGGTGCCTGACCGCAGG - Intergenic
920912663 1:210233006-210233028 CCCAGCCCGGCTCTTACCGCGGG - Exonic
922677337 1:227560984-227561006 CCGCGCGCTGCGCCTTCCGCTGG - Intergenic
1062774708 10:135504-135526 CCGCGCCCGGCCCTCCCCTCCGG - Intronic
1064218511 10:13419976-13419998 CCCCGCGTGGCCCTTGCAGCTGG + Intergenic
1065590445 10:27256986-27257008 CCGCCCGCGGCCCATGGCGCAGG + Intergenic
1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG + Intergenic
1080072638 11:28108318-28108340 ACGCGCGCGGCCGTTTCCGGAGG + Intronic
1092229078 12:6766834-6766856 CCCCGCGCGGCCCTTGCGCCCGG + Intronic
1102487629 12:113268867-113268889 CCCCACCCGGGCCTTACCGCCGG - Exonic
1110444229 13:75559328-75559350 CCGCGCCCGGCCCTCAGCCCCGG + Intronic
1114483775 14:23050942-23050964 CAGTGCTGGGCCCTTACCGCAGG - Intronic
1116705582 14:48294654-48294676 CCGCGCCCGGCCCATACCTATGG - Intergenic
1122231125 14:100306697-100306719 CCCCGCGCGTCCCCTCCCGCCGG - Intergenic
1124790111 15:32718787-32718809 CGGGGCGCGGCCCTGGCCGCGGG + Intronic
1127221713 15:56887310-56887332 CCGCGCGCGGCCCGGCCCGGCGG - Intronic
1132724712 16:1333744-1333766 CAGCCCGCGGCACTTACCGTGGG - Intronic
1135557923 16:23452798-23452820 CCGCTCGGGGCCCTGGCCGCGGG - Intronic
1142547257 17:713747-713769 CCACGCGCGGCCCTGCCTGCAGG - Intronic
1147123800 17:38352202-38352224 CCTCGCGCGGCCCGGCCCGCGGG + Intergenic
1147900135 17:43778574-43778596 CCGGGCGCGGCCCTTCCCCGTGG - Intronic
1149828156 17:59848436-59848458 CCGCGCCCGGCCCTGATCACAGG + Intergenic
1149922429 17:60672410-60672432 CCGCGCCCGGCCCTTAGAGACGG + Intergenic
1151933432 17:77247311-77247333 CTGCGAGGGGCCCTTTCCGCAGG + Intergenic
1152233329 17:79125716-79125738 CCACGCGGCGCCCTTCCCGCAGG - Intronic
1152321575 17:79610936-79610958 CCTCGCGCGCCCCTTGCCGCTGG - Intergenic
1160465147 18:79069699-79069721 CTGCCCGCGGCCCTCACCACCGG - Intronic
1160725519 19:616374-616396 CCGCGCCCAGCCCGGACCGCAGG + Exonic
1160736652 19:665750-665772 CCGCGCCCGGCCCTTTCCCCTGG + Intergenic
1160948044 19:1652451-1652473 CCCCGCGTGGCCCGTCCCGCGGG + Intronic
1160967638 19:1753623-1753645 CCGCGCGCGCTCCTCAGCGCCGG - Exonic
1162176186 19:8832208-8832230 CCGAGCCCGGCCCCTCCCGCGGG + Exonic
1163850991 19:19663551-19663573 CCGCGCGCGCTCCTTGCCGCCGG - Exonic
1164647984 19:29873237-29873259 CCCAGCGCGGGCCTTGCCGCGGG + Intergenic
1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG + Intronic
1202712855 1_KI270714v1_random:27141-27163 CCGCGCGGGTGCCTGACCGCAGG - Intergenic
925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG + Intergenic
929218224 2:39437501-39437523 CCGCGCCCGGCCGCTGCCGCCGG + Intergenic
935059276 2:99593702-99593724 CCGCGTGCGGCGCTTCTCGCAGG + Exonic
937283493 2:120736083-120736105 CGCCGCGCAGCCCCTACCGCCGG - Intronic
937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG + Exonic
941095890 2:161239013-161239035 CCCCGCGCGGCCCCCAGCGCCGG + Intergenic
944154014 2:196592747-196592769 GAGCGCGCGGCCCTCGCCGCAGG - Intronic
946366762 2:219253523-219253545 CCGCGCCCCGTCCTTTCCGCGGG - Intronic
946692368 2:222319365-222319387 AAGCGCGCGGCGCTCACCGCTGG - Intergenic
1168757384 20:326495-326517 CCCCGAGCGGCCCGTCCCGCCGG - Exonic
1170150548 20:13221924-13221946 CCGCGCACGGCCCTCTCCGGCGG - Intronic
1178454848 21:32739614-32739636 CCGCGCCCGGCCGTAACCACAGG - Intronic
1178981411 21:37267900-37267922 CCGCACCCTGCCCTTCCCGCGGG + Intronic
1179988183 21:44932556-44932578 CCACGCGCGGCCCCATCCGCAGG - Intergenic
1180559172 22:16601795-16601817 CCGCCCGCGGCCCCTCCCCCGGG - Intergenic
1185333456 22:50261653-50261675 CCGCTCCCGGCCCTTCCCTCAGG + Exonic
961762827 3:129184063-129184085 CCGCGCGCGGCCTTTCACGCCGG + Intergenic
968457164 4:705736-705758 CCGCCCACGCCCCTTGCCGCGGG + Intronic
997734491 5:136203349-136203371 CCTCCCTCTGCCCTTACCGCAGG + Intergenic
998467516 5:142357371-142357393 CCGCGCGCCGCCCTTCTCTCCGG + Intergenic
1002900031 6:1402562-1402584 CCCGGCGTGGCCCTTACTGCTGG - Intergenic
1004492521 6:16129625-16129647 CTGCGCCCGGCCCTCAGCGCTGG - Intronic
1017103346 6:150866569-150866591 CCGCGCGCGGCCCCTCCTGCTGG + Intronic
1017497637 6:154995561-154995583 CCGCGCGCCGCCCCGCCCGCAGG - Intronic
1045815085 8:106269979-106270001 CCGCGCGCGGCCCCTCTGGCTGG - Intergenic
1047288697 8:123510319-123510341 CCGCGCCCGGCCCCAACTGCAGG - Intronic
1049457307 8:142700316-142700338 CCGCTGGCGGCCCTGAACGCCGG - Exonic
1049708034 8:144051712-144051734 CAGGCCGCGGCCCTTACCCCGGG + Exonic
1055030639 9:71768976-71768998 CCCCGCCCGGCCCCTCCCGCCGG + Intronic
1062268781 9:135699493-135699515 ACGCGCACGGCCCCTTCCGCAGG + Exonic
1062435577 9:136545408-136545430 CCGCGCGTGGGGCTTGCCGCCGG - Intronic
1189324605 X:40105136-40105158 AGGCGCGCGGCCGTTCCCGCGGG + Intronic
1190121001 X:47659098-47659120 CCAAGCGCGGCCTTTACCTCAGG + Exonic