ID: 937370413

View in Genome Browser
Species Human (GRCh38)
Location 2:121293672-121293694
Sequence CAGTCTCTGCAGGGGGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937370401_937370413 27 Left 937370401 2:121293622-121293644 CCTGTTATCTGCTTCACACCTCC No data
Right 937370413 2:121293672-121293694 CAGTCTCTGCAGGGGGCCACGGG No data
937370403_937370413 6 Left 937370403 2:121293643-121293665 CCTTCTGCAAAACGCCCTGTTAC No data
Right 937370413 2:121293672-121293694 CAGTCTCTGCAGGGGGCCACGGG No data
937370400_937370413 28 Left 937370400 2:121293621-121293643 CCCTGTTATCTGCTTCACACCTC No data
Right 937370413 2:121293672-121293694 CAGTCTCTGCAGGGGGCCACGGG No data
937370406_937370413 -9 Left 937370406 2:121293658-121293680 CCTGTTACAGGTGCCAGTCTCTG No data
Right 937370413 2:121293672-121293694 CAGTCTCTGCAGGGGGCCACGGG No data
937370405_937370413 -8 Left 937370405 2:121293657-121293679 CCCTGTTACAGGTGCCAGTCTCT No data
Right 937370413 2:121293672-121293694 CAGTCTCTGCAGGGGGCCACGGG No data
937370402_937370413 9 Left 937370402 2:121293640-121293662 CCTCCTTCTGCAAAACGCCCTGT No data
Right 937370413 2:121293672-121293694 CAGTCTCTGCAGGGGGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937370413 Original CRISPR CAGTCTCTGCAGGGGGCCAC GGG Intergenic
No off target data available for this crispr