ID: 937376286

View in Genome Browser
Species Human (GRCh38)
Location 2:121338019-121338041
Sequence CAGTGCCAACATAACTATTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937376283_937376286 12 Left 937376283 2:121337984-121338006 CCAACCTGGGGGTGTGGGGACCA 0: 1
1: 0
2: 4
3: 36
4: 228
Right 937376286 2:121338019-121338041 CAGTGCCAACATAACTATTTTGG 0: 1
1: 0
2: 0
3: 4
4: 125
937376280_937376286 16 Left 937376280 2:121337980-121338002 CCACCCAACCTGGGGGTGTGGGG 0: 1
1: 0
2: 1
3: 32
4: 256
Right 937376286 2:121338019-121338041 CAGTGCCAACATAACTATTTTGG 0: 1
1: 0
2: 0
3: 4
4: 125
937376284_937376286 8 Left 937376284 2:121337988-121338010 CCTGGGGGTGTGGGGACCATGCG 0: 1
1: 0
2: 0
3: 16
4: 228
Right 937376286 2:121338019-121338041 CAGTGCCAACATAACTATTTTGG 0: 1
1: 0
2: 0
3: 4
4: 125
937376285_937376286 -8 Left 937376285 2:121338004-121338026 CCATGCGTGTGAACACAGTGCCA 0: 1
1: 0
2: 1
3: 12
4: 111
Right 937376286 2:121338019-121338041 CAGTGCCAACATAACTATTTTGG 0: 1
1: 0
2: 0
3: 4
4: 125
937376278_937376286 17 Left 937376278 2:121337979-121338001 CCCACCCAACCTGGGGGTGTGGG 0: 1
1: 0
2: 2
3: 22
4: 212
Right 937376286 2:121338019-121338041 CAGTGCCAACATAACTATTTTGG 0: 1
1: 0
2: 0
3: 4
4: 125
937376282_937376286 13 Left 937376282 2:121337983-121338005 CCCAACCTGGGGGTGTGGGGACC 0: 1
1: 0
2: 5
3: 16
4: 193
Right 937376286 2:121338019-121338041 CAGTGCCAACATAACTATTTTGG 0: 1
1: 0
2: 0
3: 4
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937376286 Original CRISPR CAGTGCCAACATAACTATTT TGG Exonic
911341874 1:96649301-96649323 TAGTGCCAAAATACCCATTTTGG - Intergenic
911712811 1:101095093-101095115 CAGTTTCAACATAAAAATTTTGG + Intergenic
918559906 1:185852799-185852821 CATTTACAACATAAATATTTGGG - Intronic
919354009 1:196498297-196498319 CAGTGCCTTGATACCTATTTAGG + Intronic
922136353 1:222830988-222831010 ATGTGCCACCATAACAATTTAGG - Intergenic
924043741 1:240008502-240008524 TAGTGCCTACATTACCATTTAGG + Intergenic
1068343460 10:55739439-55739461 CATTGGCAAAATAACTATTCTGG + Intergenic
1069399284 10:68025415-68025437 CAGTGGCAAAATAGGTATTTGGG + Intronic
1070777010 10:79115677-79115699 CAGAGACCACATATCTATTTAGG + Intronic
1072725358 10:97809520-97809542 CAGAGCCTACATTACTTTTTTGG + Intergenic
1072772978 10:98158562-98158584 AAGTGCACACTTAACTATTTAGG - Intronic
1079571146 11:21944823-21944845 CCCTGCCAATATCACTATTTTGG - Intergenic
1083341854 11:61963301-61963323 CACTTCCCCCATAACTATTTAGG + Exonic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1086248337 11:84782807-84782829 CAGATCCAAAATAACTATATAGG - Intronic
1086557231 11:88125387-88125409 CAGAACAAACATAACTTTTTTGG + Intronic
1087283737 11:96241908-96241930 CAGTTACAACATTAATATTTGGG + Intronic
1087548935 11:99621909-99621931 CAGTGCCAACAAAAAAATTGTGG - Intronic
1088323301 11:108575574-108575596 CAGGGTCAACATAACTTTTGTGG - Intronic
1088412428 11:109549716-109549738 CATTGCAGACATAACCATTTGGG + Intergenic
1089906356 11:122043877-122043899 AAGTTCCAACATAAGAATTTTGG - Intergenic
1091914228 12:4256622-4256644 CAGTGCAAACATCACTCTCTGGG + Intergenic
1092996443 12:13955452-13955474 TAGAGCCAACATAATGATTTAGG - Intronic
1093399091 12:18721562-18721584 CAGTGCCAAAGTAATTGTTTTGG + Intronic
1093434279 12:19118044-19118066 CAGAGCCAACATAACTGCTCTGG - Intergenic
1102798527 12:115710763-115710785 CAATTCCAAAATAAATATTTTGG + Intergenic
1104142850 12:126005083-126005105 CAGTGCCAACATATGTTTCTGGG - Intergenic
1104189392 12:126464459-126464481 CCATGCCCACTTAACTATTTTGG + Intergenic
1114949494 14:27730951-27730973 CAGTGCCAAATTAACGATATAGG + Intergenic
1118888256 14:69885183-69885205 CAGTTCCAACATTACTCTCTAGG + Intronic
1119056665 14:71428972-71428994 CAGCTCCAAAATAATTATTTTGG + Intronic
1120215165 14:81674161-81674183 CAGTGAGAACATTTCTATTTAGG + Intergenic
1121047021 14:90795738-90795760 AAGATCCAACATAACTATTCTGG - Intronic
1121064383 14:90948222-90948244 ATGTATCAACATAACTATTTTGG - Intronic
1123395510 15:19930687-19930709 GAGTGACAAGATATCTATTTTGG - Intergenic
1123672564 15:22674145-22674167 CAGTGTCAACATATGAATTTTGG + Intergenic
1124324614 15:28747434-28747456 CAGTGTCAACATATGAATTTTGG + Intergenic
1127176599 15:56364960-56364982 CAGTGCCAGGATAATAATTTAGG + Intronic
1130295240 15:82642875-82642897 CAGTGTAAACATTAATATTTAGG + Intronic
1135930859 16:26735421-26735443 CTGTGCCACCCTAGCTATTTGGG + Intergenic
1136281666 16:29216686-29216708 AAGTGCCCACATAACTTGTTGGG + Intergenic
1137018437 16:35398464-35398486 CAGTGTCAACATATGAATTTTGG - Intergenic
1140556037 16:75921955-75921977 CTGTACCAACATCACTATTTTGG - Intergenic
1143782396 17:9236105-9236127 AAGTTCCAACATAAGAATTTGGG + Intronic
1156146685 18:34189823-34189845 CACTGCCAATATGACTCTTTTGG - Intronic
1158668908 18:59457047-59457069 CAGGGTCAACATAGCTCTTTAGG + Intronic
1159424305 18:68264696-68264718 CAGGACCAAAATAACAATTTAGG - Intergenic
1164978545 19:32594276-32594298 CATTACCAACATGTCTATTTTGG - Intergenic
1166819817 19:45570959-45570981 CGGTGACAGCAAAACTATTTGGG + Intronic
928567970 2:32572970-32572992 CAGTGCCCACAGAGCTATATGGG - Intronic
937376286 2:121338019-121338041 CAGTGCCAACATAACTATTTTGG + Exonic
937497806 2:122442637-122442659 CAGTGCCAAAATCACTACCTAGG + Intergenic
937506634 2:122544881-122544903 CATTGCCAACATGTCCATTTGGG - Intergenic
937596166 2:123676726-123676748 CAGTGCTATCAAAACTATATTGG - Intergenic
937797299 2:126038901-126038923 CAGTTTCAACATATGTATTTTGG + Intergenic
940618900 2:156085372-156085394 TATTGCAAACCTAACTATTTTGG + Intergenic
941234741 2:162957023-162957045 TGTTGCCAACATAAGTATTTAGG - Intergenic
941317590 2:164013922-164013944 CAGTACCAGCTGAACTATTTAGG - Intergenic
944651989 2:201839588-201839610 AAATACCAACATAATTATTTAGG + Intronic
1170878824 20:20276816-20276838 CATTGCCAACATTAGTAATTTGG + Intronic
1170980681 20:21209228-21209250 CAGTGCCCACATAACCTATTAGG + Intronic
1177361646 21:20080165-20080187 GAGAGCTAAGATAACTATTTTGG - Intergenic
1178138564 21:29656008-29656030 GATTACCAAAATAACTATTTGGG + Intronic
1178723320 21:35029435-35029457 CAGAGCCAGCATAACAATGTTGG + Intronic
1179280486 21:39929997-39930019 CACTGCCTACAAAACTACTTCGG - Intergenic
1179806799 21:43844152-43844174 CAAGGCCAAGATAACTATATTGG - Intergenic
1181076798 22:20383981-20384003 CAGTGGCAACCTAAATCTTTAGG - Intronic
1181094905 22:20498066-20498088 CAGTTCCAACATATGAATTTTGG - Intronic
950765283 3:15268741-15268763 CAGTTTCAACATAAGAATTTTGG - Intronic
951145921 3:19227117-19227139 TAGAGCCAACATTACTCTTTGGG + Intronic
953026779 3:39149913-39149935 CAGTCTCAACATAAGAATTTTGG - Intronic
954048063 3:47949968-47949990 GAGTGCCAACAAAACTGTCTAGG - Intronic
956990378 3:74755966-74755988 CAGTACCAAGATAAATATTGCGG - Intergenic
957959346 3:87228577-87228599 CAATGCCAGCAAAATTATTTTGG + Intronic
962600103 3:136985030-136985052 GAGTGCCTACAAAACTATGTGGG + Intronic
964861604 3:161208669-161208691 GAATGCCATCATAACCATTTAGG + Intronic
965077624 3:163999529-163999551 CAGGGCCAAACTAACGATTTTGG + Intergenic
970570811 4:17380585-17380607 CTATCCCAAAATAACTATTTGGG + Intergenic
972875046 4:43348526-43348548 TGGTGCCAACATAACTTTTCAGG - Intergenic
976979878 4:91214267-91214289 AAGTGCCCACATAAATATGTAGG + Intronic
977235035 4:94498020-94498042 CAGTGAGAAAATAACTCTTTTGG - Intronic
980271396 4:130588820-130588842 TAATGCCAACACCACTATTTAGG - Intergenic
980493543 4:133560956-133560978 CACTGCCATCAATACTATTTTGG + Intergenic
981409351 4:144410482-144410504 CAATGCCACCATAGCTATTATGG + Intergenic
981961684 4:150548302-150548324 CAGTGCACACCCAACTATTTGGG + Intronic
984053060 4:174891300-174891322 CAGTGCAAAGATGGCTATTTAGG - Intronic
992881602 5:81115844-81115866 CAGACACAACATAACTATATGGG + Intronic
994468599 5:100171772-100171794 CATTGCAAACATATCTCTTTAGG - Intergenic
999734249 5:154500751-154500773 CAGTTCCAACATACGAATTTTGG + Intergenic
1000402077 5:160839995-160840017 CAATACCAACAAAAATATTTAGG + Intronic
1002930344 6:1630150-1630172 CACAGACAACATAATTATTTAGG + Intronic
1006469193 6:34217109-34217131 CAGGCCCAACATACCTTTTTGGG - Intergenic
1006761232 6:36463542-36463564 AAGTTCCAACACAACAATTTTGG - Intronic
1007133392 6:39497886-39497908 GAGAGCCAACTTAATTATTTTGG + Intronic
1008145207 6:47883304-47883326 AAGTGCCAATATAATTTTTTAGG - Intronic
1008326500 6:50188068-50188090 CAGTATCAACATACCCATTTTGG + Intergenic
1013127242 6:107196206-107196228 CAGTGTAGACAAAACTATTTTGG - Intronic
1014160255 6:118159310-118159332 CAATGTCAACAAAACTACTTTGG - Intronic
1015130794 6:129806880-129806902 CAGTAACAACAGAACTTTTTGGG + Intergenic
1015217249 6:130764114-130764136 CTGTGCCAACATAAAAATTTTGG - Intergenic
1015499004 6:133910798-133910820 CAGTTCTAAAATTACTATTTAGG - Intergenic
1015821305 6:137263896-137263918 CAGTGGGAAAATAACTATATGGG - Intergenic
1015906323 6:138121013-138121035 CAGTGTCAACATATGAATTTTGG - Intergenic
1016599446 6:145841471-145841493 AAGTTCCAACATAAGAATTTTGG + Intergenic
1020830917 7:13094404-13094426 CAGTACCAACATATTAATTTAGG - Intergenic
1024513647 7:50223705-50223727 CAGTGCCAACATTATTCATTTGG + Intergenic
1025488346 7:61079984-61080006 GAATGACAACATATCTATTTTGG + Intergenic
1025822457 7:64980871-64980893 CAGTGCCAATATACCTTTTCAGG - Intronic
1030200136 7:106894689-106894711 CAGAGGCAACATTACTATTTAGG + Intronic
1030537714 7:110789855-110789877 GAGTGGCCACATAAATATTTGGG - Intronic
1030713657 7:112784306-112784328 CATTGCCAGCACAACTATGTTGG - Exonic
1030791632 7:113737084-113737106 CAGTGCTGATATAACTATTTAGG + Intergenic
1036494846 8:9260886-9260908 CAGTGCCAACAGCACAATGTGGG + Intergenic
1037674437 8:21041634-21041656 CATTGCTATCATTACTATTTTGG + Intergenic
1040719695 8:50303968-50303990 AAGTGCAAACATATCTGTTTTGG - Intronic
1045402447 8:101832732-101832754 AAATGCCAACATAAATATTGTGG + Intronic
1045739626 8:105341212-105341234 GAGAGCCAATATAATTATTTTGG - Intronic
1045881425 8:107045513-107045535 CAGTGACAACATACCAAGTTTGG - Intergenic
1046438971 8:114234061-114234083 AAGTTCCAACATAAAAATTTTGG - Intergenic
1046877476 8:119271765-119271787 AAGTGCAAAGATAACTTTTTTGG + Intergenic
1047808864 8:128386137-128386159 CAGTGCCAACAAAAATGTTATGG + Intergenic
1052389058 9:27856810-27856832 AAGACCCAAAATAACTATTTCGG - Intergenic
1052490364 9:29159208-29159230 TAGTGCCAACCTATTTATTTTGG - Intergenic
1059101320 9:111474634-111474656 GAATGCCAACAGAACTAGTTTGG - Intronic
1060332802 9:122690106-122690128 CATTGTCTACATAAATATTTAGG - Intergenic
1192885517 X:75333864-75333886 CATTGCCAAAATTACTTTTTTGG + Intergenic
1193512023 X:82414402-82414424 CAGTGCAACCATAACTAATGAGG + Intergenic
1195476103 X:105287568-105287590 TAGTGCAAGCATAACTATTCAGG - Intronic
1197521441 X:127502802-127502824 CAGTGTCACCTTAACTATCTAGG + Intergenic
1199140743 X:144308971-144308993 CAGTTCCAACATAAGTCTGTCGG + Intergenic