ID: 937380141

View in Genome Browser
Species Human (GRCh38)
Location 2:121368977-121368999
Sequence TCTCCCTTCCCCACAACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937380133_937380141 24 Left 937380133 2:121368930-121368952 CCAAAACTTTCTCATCATTCCCA No data
Right 937380141 2:121368977-121368999 TCTCCCTTCCCCACAACCCCTGG No data
937380135_937380141 4 Left 937380135 2:121368950-121368972 CCAACAAAAACCCTGCATCCTCA No data
Right 937380141 2:121368977-121368999 TCTCCCTTCCCCACAACCCCTGG No data
937380134_937380141 5 Left 937380134 2:121368949-121368971 CCCAACAAAAACCCTGCATCCTC No data
Right 937380141 2:121368977-121368999 TCTCCCTTCCCCACAACCCCTGG No data
937380132_937380141 25 Left 937380132 2:121368929-121368951 CCCAAAACTTTCTCATCATTCCC No data
Right 937380141 2:121368977-121368999 TCTCCCTTCCCCACAACCCCTGG No data
937380137_937380141 -7 Left 937380137 2:121368961-121368983 CCTGCATCCTCATCCCTCTCCCT No data
Right 937380141 2:121368977-121368999 TCTCCCTTCCCCACAACCCCTGG No data
937380136_937380141 -6 Left 937380136 2:121368960-121368982 CCCTGCATCCTCATCCCTCTCCC No data
Right 937380141 2:121368977-121368999 TCTCCCTTCCCCACAACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937380141 Original CRISPR TCTCCCTTCCCCACAACCCC TGG Intronic
No off target data available for this crispr