ID: 937385068

View in Genome Browser
Species Human (GRCh38)
Location 2:121422064-121422086
Sequence CTTCTGCTTACATGAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937385066_937385068 -5 Left 937385066 2:121422046-121422068 CCTAGGTACCTCTGGGGTCTTCT No data
Right 937385068 2:121422064-121422086 CTTCTGCTTACATGAAATGCTGG No data
937385061_937385068 12 Left 937385061 2:121422029-121422051 CCTAAAAAAGCAGTATTCCTAGG No data
Right 937385068 2:121422064-121422086 CTTCTGCTTACATGAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937385068 Original CRISPR CTTCTGCTTACATGAAATGC TGG Intronic
No off target data available for this crispr