ID: 937394939

View in Genome Browser
Species Human (GRCh38)
Location 2:121526378-121526400
Sequence GGCTCAGATGTGCCCCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937394939_937394942 -5 Left 937394939 2:121526378-121526400 CCCTACTGGGGCACATCTGAGCC No data
Right 937394942 2:121526396-121526418 GAGCCAAGTACTGCCCTACTGGG No data
937394939_937394943 -4 Left 937394939 2:121526378-121526400 CCCTACTGGGGCACATCTGAGCC No data
Right 937394943 2:121526397-121526419 AGCCAAGTACTGCCCTACTGGGG No data
937394939_937394941 -6 Left 937394939 2:121526378-121526400 CCCTACTGGGGCACATCTGAGCC No data
Right 937394941 2:121526395-121526417 TGAGCCAAGTACTGCCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937394939 Original CRISPR GGCTCAGATGTGCCCCAGTA GGG (reversed) Intronic
No off target data available for this crispr