ID: 937395410

View in Genome Browser
Species Human (GRCh38)
Location 2:121530383-121530405
Sequence TAGGCCTCCCCGGAGCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937395410_937395422 30 Left 937395410 2:121530383-121530405 CCCACCCGCTCCGGGGAGGCCTA 0: 1
1: 0
2: 0
3: 2
4: 80
Right 937395422 2:121530436-121530458 TCCAGACGCATGCCGACTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 27
937395410_937395421 27 Left 937395410 2:121530383-121530405 CCCACCCGCTCCGGGGAGGCCTA 0: 1
1: 0
2: 0
3: 2
4: 80
Right 937395421 2:121530433-121530455 GAGTCCAGACGCATGCCGACTGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937395410 Original CRISPR TAGGCCTCCCCGGAGCGGGT GGG (reversed) Intronic
901551358 1:9997841-9997863 TCGGCGCACCCGGAGCGGGTCGG + Intronic
904792835 1:33036638-33036660 TGGACCTGCCCGGAGCGGGCCGG - Intronic
905899579 1:41572442-41572464 GAGGGCTTCCCGGAGTGGGTGGG - Intronic
915088359 1:153404307-153404329 TGGGCCTCCACAGAGCGGCTGGG - Intergenic
915096532 1:153466514-153466536 TGGGCCTCCAGGGAGCGGCTGGG + Intergenic
1063450280 10:6145843-6145865 TGGGACCCCCCGGTGCGGGTAGG - Intronic
1076021549 10:127077821-127077843 AAGGCCTCCTCAGAGCAGGTTGG + Intronic
1084117759 11:67051954-67051976 CAGGCCTCCCAGGAGCTGCTGGG - Intergenic
1084185271 11:67468043-67468065 CAGGCCTCTCCGGAGCCGGATGG - Exonic
1094465987 12:30754619-30754641 TTGGCATCCCCGGGGCGGGGCGG - Intronic
1104952312 12:132446993-132447015 TAAGCCTCCCCGGAGCTTGATGG + Intergenic
1113175127 13:107554957-107554979 GAGGCCTCCCCGGACAGGTTAGG - Intronic
1114761954 14:25325786-25325808 AAGGCCTCCACGGATCAGGTAGG + Intergenic
1122657682 14:103273350-103273372 GAGGCCTCCGCGGATCGGGCGGG - Intergenic
1128061860 15:64740494-64740516 TGGGCCTCCCTGAAGCGGGGTGG + Exonic
1128388399 15:67166451-67166473 GACGCCTCCCTGGAGGGGGTGGG + Intronic
1128760623 15:70213999-70214021 TAGGCCTCCATGGAGCAGGGAGG - Intergenic
1132729045 16:1351722-1351744 AAGGCCTCCAGGGAGCGCGTCGG + Exonic
1136580209 16:31147082-31147104 TGGGCGTCCCTGGAGCTGGTGGG + Intronic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG + Intergenic
1136878763 16:33885482-33885504 TGGGCTTCCCCCGAGCGGTTGGG - Intergenic
1139960013 16:70712077-70712099 TCAGCCTCCCGGGAGGGGGTGGG - Intronic
1141660908 16:85440979-85441001 TTGGCCTCCCGGGAGCTGGCTGG - Intergenic
1141778171 16:86138252-86138274 AAGGCCTCCCTGGATGGGGTGGG + Intergenic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1142602539 17:1061256-1061278 CAAGCCTCCCAGGGGCGGGTGGG + Intronic
1142610824 17:1108633-1108655 GCCGCCTCCCTGGAGCGGGTGGG - Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1152143868 17:78555778-78555800 TAGCCCTCCCCAGTGTGGGTGGG + Intronic
1158236598 18:55322582-55322604 CCGGCCTCCCCGGAGCTGGTGGG + Intronic
1162789730 19:13056572-13056594 TCGGCCTCCCTGGAGTGGGGTGG + Intronic
1162797162 19:13092810-13092832 GAGGCATCCCCAGAGTGGGTGGG - Intronic
1167990703 19:53358323-53358345 TAGGGATCCCCGGGGCGGGGCGG - Intergenic
933723602 2:85413630-85413652 TAGGACTCTCGGGAGCGGCTAGG + Intronic
934079199 2:88452747-88452769 TGGGCCGGCCCGGAGCGGGGCGG + Intergenic
935717133 2:105949036-105949058 TGGCCCTCCCCCGTGCGGGTGGG + Intergenic
937395410 2:121530383-121530405 TAGGCCTCCCCGGAGCGGGTGGG - Intronic
946439736 2:219685200-219685222 CAGGGCTCGCCGGAGCGGCTCGG + Intergenic
948903095 2:240965957-240965979 TGGGCCTCCCCGGAGCAGCCTGG + Intronic
949004556 2:241637776-241637798 TTGGCCTCCCCTGCTCGGGTCGG + Intronic
1171837190 20:30168117-30168139 CAGGCCTGCCCGGACCGTGTTGG - Intergenic
1171846754 20:30281979-30282001 CAGGCCTGCCCGGACCGTGTTGG + Intergenic
1179596138 21:42444302-42444324 TAGGCCTCCCTGAGGCTGGTGGG + Intronic
1184374338 22:44102249-44102271 CAGCCCTCCCCAAAGCGGGTGGG - Intronic
1184606157 22:45575963-45575985 CATGCCTCCCCTGAGAGGGTGGG - Intronic
953032102 3:39185891-39185913 TGGGCCTCCCTGGAGTGGGCGGG + Exonic
974916328 4:68182758-68182780 GAGGCCTGCCCAGCGCGGGTTGG - Intergenic
985674151 5:1221653-1221675 TAGGCATCCCGGGAGCCAGTGGG - Intronic
991500738 5:67274238-67274260 TAGGCCTTCCCGGAATGGGCAGG - Intergenic
999153761 5:149443626-149443648 GAGGCCTTCCTGGAGTGGGTCGG + Intergenic
1002277676 5:178114148-178114170 GAGGCCTGCCGGGAGCGGCTGGG - Intronic
1002524647 5:179808132-179808154 CGGGCCTCCCCCGGGCGGGTGGG - Intronic
1014253541 6:119139321-119139343 CAGGCCTCTCTGGAGCGGCTGGG + Intronic
1018424975 6:163671772-163671794 CAGCCCTCCCCAGAGCTGGTGGG + Intergenic
1019492070 7:1318936-1318958 TAGGCCTCCTGGGACCGAGTGGG - Intergenic
1023831260 7:44040132-44040154 GTGGCCTCGCCGGAGCCGGTAGG + Intergenic
1026774149 7:73220792-73220814 TAGTCCTCACTGGAGCTGGTTGG - Intergenic
1027015006 7:74774178-74774200 TAGTCCTCACTGGAGCTGGTTGG - Intronic
1027073025 7:75171775-75171797 TAGTCCTCACTGGAGCTGGTTGG + Intergenic
1029409182 7:100397921-100397943 TGGGCCTCCCCAGGGTGGGTTGG + Intronic
1029483076 7:100824512-100824534 TAGGCCTCCCTGGAGGAGGGAGG + Intronic
1029741590 7:102494438-102494460 GTGGCCTCGCCGGAGCCGGTAGG + Intronic
1029759581 7:102593607-102593629 GTGGCCTCGCCGGAGCCGGTAGG + Intronic
1029776948 7:102689517-102689539 GTGGCCTCGCCGGAGCCGGTAGG + Intergenic
1034266176 7:149782121-149782143 GAAGCCTCTCCGGAGAGGGTTGG + Intergenic
1035377245 7:158413636-158413658 TAGTCCTCCCGGGAGAGGGGTGG - Intronic
1035453977 7:158997214-158997236 AGGGGCTCCCCGGAGCGCGTGGG - Intergenic
1036910468 8:12754364-12754386 GAGGCCGCCCCGGCGCGGGATGG - Intronic
1037547760 8:19940170-19940192 CGGGGCTCCCCAGAGCGGGTGGG - Intronic
1043381351 8:79705532-79705554 TAGGCCTCATGGGAGAGGGTAGG + Intergenic
1047489381 8:125362094-125362116 CAGGCCTCGCAGGAGCGGCTGGG - Intronic
1048030222 8:130624576-130624598 TAGGCCTCCACGCAGCTGTTTGG + Intergenic
1053137112 9:35658266-35658288 GTGGCCTCCCCGGAGCCGGCCGG + Intergenic
1056732496 9:89178183-89178205 TCGGCCGCCCGGGAGCGGGCGGG - Exonic
1057131862 9:92659770-92659792 TAGGGCTGCGGGGAGCGGGTGGG - Intronic
1061852056 9:133422144-133422166 TAGGCCTCCTCTAAGGGGGTGGG + Exonic
1061878002 9:133554534-133554556 CAGGCCTCCTCAGAGCGGCTGGG + Exonic
1062076148 9:134590983-134591005 TAGGACTCCACGGAGAGGGAAGG + Intergenic
1062564278 9:137157044-137157066 GGGGCCTCCCCGGAGCTGGGCGG + Intronic
1062681644 9:137785188-137785210 TAGGCCTCCCAGGAGAGGAGAGG - Intronic
1185483151 X:463170-463192 GAGGACTCCCCGGGGAGGGTGGG + Intergenic
1191871796 X:65752366-65752388 TAGGGCTACCTGGAGGGGGTTGG - Intergenic