ID: 937397899

View in Genome Browser
Species Human (GRCh38)
Location 2:121554658-121554680
Sequence TCTGGACATTTCCTATAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937397899_937397904 28 Left 937397899 2:121554658-121554680 CCCATTTATAGGAAATGTCCAGA No data
Right 937397904 2:121554709-121554731 GACACACCATTGCCTAGAGCTGG No data
937397899_937397906 30 Left 937397899 2:121554658-121554680 CCCATTTATAGGAAATGTCCAGA No data
Right 937397906 2:121554711-121554733 CACACCATTGCCTAGAGCTGGGG No data
937397899_937397905 29 Left 937397899 2:121554658-121554680 CCCATTTATAGGAAATGTCCAGA No data
Right 937397905 2:121554710-121554732 ACACACCATTGCCTAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937397899 Original CRISPR TCTGGACATTTCCTATAAAT GGG (reversed) Intronic
No off target data available for this crispr