ID: 937397900

View in Genome Browser
Species Human (GRCh38)
Location 2:121554659-121554681
Sequence TTCTGGACATTTCCTATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5987
Summary {0: 19, 1: 459, 2: 1304, 3: 1878, 4: 2327}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937397900_937397906 29 Left 937397900 2:121554659-121554681 CCATTTATAGGAAATGTCCAGAA 0: 19
1: 459
2: 1304
3: 1878
4: 2327
Right 937397906 2:121554711-121554733 CACACCATTGCCTAGAGCTGGGG No data
937397900_937397905 28 Left 937397900 2:121554659-121554681 CCATTTATAGGAAATGTCCAGAA 0: 19
1: 459
2: 1304
3: 1878
4: 2327
Right 937397905 2:121554710-121554732 ACACACCATTGCCTAGAGCTGGG No data
937397900_937397907 30 Left 937397900 2:121554659-121554681 CCATTTATAGGAAATGTCCAGAA 0: 19
1: 459
2: 1304
3: 1878
4: 2327
Right 937397907 2:121554712-121554734 ACACCATTGCCTAGAGCTGGGGG No data
937397900_937397904 27 Left 937397900 2:121554659-121554681 CCATTTATAGGAAATGTCCAGAA 0: 19
1: 459
2: 1304
3: 1878
4: 2327
Right 937397904 2:121554709-121554731 GACACACCATTGCCTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937397900 Original CRISPR TTCTGGACATTTCCTATAAA TGG (reversed) Intronic
Too many off-targets to display for this crispr