ID: 937397903

View in Genome Browser
Species Human (GRCh38)
Location 2:121554676-121554698
Sequence TTCTACTGATTTGCCCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937397903_937397905 11 Left 937397903 2:121554676-121554698 CCAGAAAGGGCAAATCAGTAGAA No data
Right 937397905 2:121554710-121554732 ACACACCATTGCCTAGAGCTGGG No data
937397903_937397907 13 Left 937397903 2:121554676-121554698 CCAGAAAGGGCAAATCAGTAGAA No data
Right 937397907 2:121554712-121554734 ACACCATTGCCTAGAGCTGGGGG No data
937397903_937397904 10 Left 937397903 2:121554676-121554698 CCAGAAAGGGCAAATCAGTAGAA No data
Right 937397904 2:121554709-121554731 GACACACCATTGCCTAGAGCTGG No data
937397903_937397906 12 Left 937397903 2:121554676-121554698 CCAGAAAGGGCAAATCAGTAGAA No data
Right 937397906 2:121554711-121554733 CACACCATTGCCTAGAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937397903 Original CRISPR TTCTACTGATTTGCCCTTTC TGG (reversed) Intronic
No off target data available for this crispr