ID: 937397904

View in Genome Browser
Species Human (GRCh38)
Location 2:121554709-121554731
Sequence GACACACCATTGCCTAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937397899_937397904 28 Left 937397899 2:121554658-121554680 CCCATTTATAGGAAATGTCCAGA No data
Right 937397904 2:121554709-121554731 GACACACCATTGCCTAGAGCTGG No data
937397903_937397904 10 Left 937397903 2:121554676-121554698 CCAGAAAGGGCAAATCAGTAGAA No data
Right 937397904 2:121554709-121554731 GACACACCATTGCCTAGAGCTGG No data
937397900_937397904 27 Left 937397900 2:121554659-121554681 CCATTTATAGGAAATGTCCAGAA 0: 19
1: 459
2: 1304
3: 1878
4: 2327
Right 937397904 2:121554709-121554731 GACACACCATTGCCTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937397904 Original CRISPR GACACACCATTGCCTAGAGC TGG Intronic
No off target data available for this crispr