ID: 937397938

View in Genome Browser
Species Human (GRCh38)
Location 2:121555086-121555108
Sequence GTGCAGACCCAGAGTCCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937397933_937397938 22 Left 937397933 2:121555041-121555063 CCTGGGTCAGGAACTGAGAGTTG No data
Right 937397938 2:121555086-121555108 GTGCAGACCCAGAGTCCTAATGG No data
937397932_937397938 23 Left 937397932 2:121555040-121555062 CCCTGGGTCAGGAACTGAGAGTT No data
Right 937397938 2:121555086-121555108 GTGCAGACCCAGAGTCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937397938 Original CRISPR GTGCAGACCCAGAGTCCTAA TGG Intronic
No off target data available for this crispr