ID: 937408115

View in Genome Browser
Species Human (GRCh38)
Location 2:121649292-121649314
Sequence GGCGCCCGCCACTGCGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937408101_937408115 21 Left 937408101 2:121649248-121649270 CCAAGAGCCGATGACAGCGCTGG 0: 1
1: 0
2: 0
3: 11
4: 105
Right 937408115 2:121649292-121649314 GGCGCCCGCCACTGCGCGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 129
937408105_937408115 -8 Left 937408105 2:121649277-121649299 CCCCCACCCAGACCCGGCGCCCG 0: 1
1: 0
2: 4
3: 38
4: 405
Right 937408115 2:121649292-121649314 GGCGCCCGCCACTGCGCGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 129
937408100_937408115 22 Left 937408100 2:121649247-121649269 CCCAAGAGCCGATGACAGCGCTG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 937408115 2:121649292-121649314 GGCGCCCGCCACTGCGCGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 129
937408106_937408115 -9 Left 937408106 2:121649278-121649300 CCCCACCCAGACCCGGCGCCCGC 0: 1
1: 0
2: 3
3: 44
4: 515
Right 937408115 2:121649292-121649314 GGCGCCCGCCACTGCGCGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 129
937408107_937408115 -10 Left 937408107 2:121649279-121649301 CCCACCCAGACCCGGCGCCCGCC 0: 1
1: 0
2: 9
3: 31
4: 346
Right 937408115 2:121649292-121649314 GGCGCCCGCCACTGCGCGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 129
937408103_937408115 14 Left 937408103 2:121649255-121649277 CCGATGACAGCGCTGGACATCGC 0: 1
1: 0
2: 0
3: 6
4: 31
Right 937408115 2:121649292-121649314 GGCGCCCGCCACTGCGCGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937408115 Original CRISPR GGCGCCCGCCACTGCGCGGG AGG Intronic
900325701 1:2107791-2107813 GGCTCCCGACACTGCCCTGGGGG - Intronic
900325740 1:2107897-2107919 GGCTCCCGACACTGCCCTGGGGG - Intronic
902027478 1:13394862-13394884 GGCGCCCCCCACTTCTCGGACGG + Intergenic
902385568 1:16073639-16073661 AGCGGCGGGCACTGCGCGGGAGG - Intergenic
904030482 1:27530406-27530428 GGCGCGCGCCACTGCGCCCAAGG + Intergenic
904822770 1:33256278-33256300 GGCGCTGGCGACTGCGCGAGAGG - Intergenic
905066844 1:35192089-35192111 TGCGCGCGCCGCTGCGGGGGCGG - Intronic
905174003 1:36125128-36125150 GGCGTCCGCGGCTGGGCGGGCGG + Exonic
910981244 1:92961547-92961569 GGCGCGCGCCGCGGCGGGGGCGG - Intergenic
911072916 1:93846722-93846744 GGGGCCCGCGACTGCGTGGGCGG - Intronic
912798406 1:112706614-112706636 GGGGCCTGCCACTGCTCGGCAGG - Intronic
916992322 1:170257291-170257313 GGCGCCCCCCACTACGCCTGGGG + Intergenic
922933546 1:229407934-229407956 GTCGCCCGCCTCTGAGCGTGTGG - Intergenic
1063444081 10:6097524-6097546 GGTGCCCACCACTGCGCCCGCGG - Intronic
1063444201 10:6098718-6098740 GGCGCCCACCACTGCGCCTGCGG + Intronic
1065712615 10:28532675-28532697 GGCCCCCGCCCCTGCGCTGTCGG - Intronic
1069419153 10:68231196-68231218 GGCGCGCGCCTCCGCGGGGGTGG - Exonic
1069982284 10:72260904-72260926 GGCTCCTCCCACTGCCCGGGAGG - Intergenic
1072021878 10:91410462-91410484 CTCGCCCGCCACTCCGCTGGTGG + Exonic
1072591656 10:96832833-96832855 GGCGGCGGCCACAGCGCGGGTGG - Intronic
1073325968 10:102644122-102644144 GGCTCCGGCCCCTGCGAGGGAGG + Intergenic
1073875268 10:107914934-107914956 GGCGCGGGGCTCTGCGCGGGCGG + Intergenic
1077685081 11:4283425-4283447 GGCGCCCCCCACTTCCCGGACGG - Intergenic
1078699743 11:13668966-13668988 GGCGCCCGCCTCACCCCGGGTGG + Intronic
1079616940 11:22506771-22506793 GGCGCCCGCCACCACGCGCCTGG + Intergenic
1082706312 11:56497508-56497530 GGCGCCCCCCACCTCCCGGGCGG - Intergenic
1082986191 11:59172698-59172720 CGCGCCGGCCCCCGCGCGGGGGG + Exonic
1083682810 11:64359121-64359143 GGCGCCCGCCTCGGCCCCGGAGG + Intergenic
1083920650 11:65780177-65780199 GGCGGCCACCACTGCCCTGGCGG - Exonic
1085641587 11:78196378-78196400 GGCGCGCGCCTCTACGTGGGCGG + Exonic
1087505900 11:99020825-99020847 GGCGCCGGTGACAGCGCGGGCGG + Intergenic
1090268729 11:125371013-125371035 GGAGCCTGCCAGTGCCCGGGAGG + Intronic
1094849075 12:34374262-34374284 GGGACCCGCGACTGCGCGGTGGG + Intergenic
1096747610 12:53738815-53738837 GGCGCCCACCACTCTGCTGGTGG + Intergenic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1103692489 12:122786813-122786835 GGCGCCCGCCACCTCGCCCGGGG - Intronic
1104989719 12:132618806-132618828 GGCGGCGGCCATGGCGCGGGCGG - Exonic
1110148378 13:72221448-72221470 GGCGCCTGCCACTGGGAAGGTGG + Intergenic
1110705964 13:78602229-78602251 GGCGCCCACGACGGCCCGGGGGG - Exonic
1111220946 13:85205189-85205211 GGAGCCCACCACGGGGCGGGGGG - Intergenic
1113456424 13:110452275-110452297 GGCGCCCGCCACCGCGCAGCTGG + Intronic
1118184329 14:63523117-63523139 GGCGCCCCCCACTTCCCGGAAGG - Intronic
1124641638 15:31399741-31399763 GGCACCAGCCACTGGGAGGGAGG + Intronic
1128454140 15:67823270-67823292 GGCGCTAGCGACTGCGCGGGCGG + Intronic
1130960917 15:88658159-88658181 GGTGCCCAGCACTGGGCGGGGGG + Intergenic
1132724674 16:1333610-1333632 GGCGGACGCCGCTGCGGGGGCGG - Intronic
1132764312 16:1526590-1526612 GGCGCCCGCCATGGGGTGGGTGG - Intronic
1138156708 16:54712382-54712404 AGCGCCCGCCACTGTGCAGATGG + Intergenic
1138389987 16:56663089-56663111 GGCGCCCGCTAGTGCGGGAGGGG + Intronic
1140046187 16:71441850-71441872 GGCGCCAGCACCTCCGCGGGCGG + Intergenic
1142064180 16:88051131-88051153 GAGGCCCGCCACTACACGGGAGG - Intronic
1142145506 16:88491318-88491340 GGTCCCTGCCACTGCGTGGGTGG - Intronic
1143003704 17:3812951-3812973 GGCGCCAGCTCCTGCGGGGGAGG + Exonic
1144391082 17:14793943-14793965 GCCGGCAGCCACTGCGCGGGGGG + Intergenic
1146181334 17:30700024-30700046 GGCGCCCGCCACCACGCTGTAGG + Intergenic
1146646305 17:34579500-34579522 GGCGCCCGCTTCTGCCCGGGTGG + Intergenic
1148740642 17:49890615-49890637 GGCGCCCGGCACTGCTGGGCTGG - Intergenic
1151736061 17:75941045-75941067 CGCGCCCGCCTTTCCGCGGGAGG - Intronic
1152396543 17:80036540-80036562 GGCGCGCGCCTCTGCGTGCGTGG + Intergenic
1153515100 18:5895211-5895233 GGCTCCCGCCACAGCGCCGGCGG - Exonic
1154070793 18:11149647-11149669 GGAGCCCGCCCCTGAGCGGCTGG + Intergenic
1156008444 18:32470477-32470499 GGCGGCCGCCGAGGCGCGGGTGG - Intronic
1156171652 18:34493648-34493670 GGAGCCCGCCGCGGGGCGGGAGG + Intronic
1157719952 18:49916027-49916049 GGAGCCCGCACCTGAGCGGGTGG - Intronic
1157799686 18:50609304-50609326 GGCGCCCCCCACCTCCCGGGCGG + Intronic
1160824146 19:1071570-1071592 GGCACCCGGCACTCCGCGCGCGG - Intronic
1161157497 19:2740182-2740204 TGCGCCCGCCGCTCAGCGGGAGG - Intergenic
1161487359 19:4543461-4543483 GGGGCCCCCCACTCCGCGGGTGG + Exonic
1161494914 19:4581474-4581496 GGCCGCCGCGAGTGCGCGGGCGG + Intergenic
1161583618 19:5093602-5093624 GGCGCCCGCATCTGCGCTGATGG - Intronic
1163320567 19:16572324-16572346 GGCGCGGGCCACGGCGCGGGGGG - Exonic
1164051155 19:21586632-21586654 GCCGCCCGCCCCGGCGCGGAGGG - Intergenic
925959725 2:9003653-9003675 GTCGCCCGGCACAGCGCGAGCGG - Exonic
929604191 2:43224569-43224591 GGCGCCGGCGGCTGCGCGGGGGG + Exonic
935590943 2:104845011-104845033 GGGGGCCGCGGCTGCGCGGGAGG - Intergenic
937408115 2:121649292-121649314 GGCGCCCGCCACTGCGCGGGAGG + Intronic
938058361 2:128233470-128233492 GGCGCCCGCGTCTCCGCCGGGGG + Intergenic
943767584 2:191678765-191678787 GGCGCCGGCCGCTGCGCGCCCGG + Intronic
943875348 2:193060757-193060779 GGCGCCCGCCACCGCGCCCGAGG + Intergenic
944154145 2:196593264-196593286 GGCGCCCTCCCGAGCGCGGGCGG - Intronic
944271327 2:197786847-197786869 GTCGCCCCCTACCGCGCGGGTGG - Intergenic
946310558 2:218880617-218880639 GGCTCCCGGCGCTGCGCTGGAGG + Exonic
947506655 2:230713046-230713068 GGCGGCGGCGGCTGCGCGGGCGG - Exonic
947992131 2:234496600-234496622 GGCGCCAGCCACTGCGGCTGCGG + Exonic
1169244599 20:4015587-4015609 GGCGCCCGCCCCTCCCCCGGCGG - Intergenic
1170026072 20:11891013-11891035 GGCGCGCGCCCCTGCCCGGGCGG - Intronic
1173251541 20:41366476-41366498 GGCGCCCGCGGCTGCGCCCGGGG - Exonic
1173576559 20:44116002-44116024 GGCTCCCGCGACGGCGCAGGCGG + Exonic
1175361142 20:58413731-58413753 GGCGCCCGTCACCTCCCGGGTGG + Intronic
1175428744 20:58888781-58888803 GGCGCGCGCCGCTGGGAGGGCGG + Intronic
1180699567 22:17774151-17774173 GGCGCCCTCCTCGGCGCGGCCGG - Intronic
1180876835 22:19178635-19178657 GGCGGCCGCCAGAGCGCGCGGGG + Exonic
1180960609 22:19760768-19760790 GGCGCCCGCCACTCGGCCCGCGG + Intronic
1181084090 22:20431361-20431383 GGCACGCGCCGCTCCGCGGGTGG + Exonic
1182664032 22:31944525-31944547 GGCGCGAGCCACAGCGCGCGGGG + Exonic
1185306343 22:50119318-50119340 GGCACCCGCCAATGCCCGCGTGG - Intronic
950729685 3:14947229-14947251 GGAGGCCGCCACTGCGAGGACGG + Intergenic
952152361 3:30606831-30606853 GGCGCCGTCCGCTGCGCTGGGGG + Exonic
959978567 3:112488756-112488778 GGCACCTGCCACTGCGCCCGGGG + Intronic
966390821 3:179451175-179451197 GGCGGCCGACGCTGCCCGGGAGG - Intronic
969103059 4:4784493-4784515 GGCGCTGGCCACTGCCCCGGAGG - Intergenic
969197254 4:5572943-5572965 AGGGCCCGCCACTGCTCGTGGGG - Intronic
975552852 4:75630839-75630861 GGCGCCCGCCCCTGCCCCAGCGG - Intergenic
982784274 4:159523437-159523459 GGCGCCCCTCACTGGCCGGGCGG - Intergenic
985006006 4:185535662-185535684 CGCGCCCGCCGCGGCCCGGGAGG - Intergenic
985964047 5:3326210-3326232 AGCGCCCGCCGCGGCGCGGGTGG - Intergenic
986402788 5:7396046-7396068 CGCCACCGCCACCGCGCGGGAGG - Intergenic
987340447 5:16935472-16935494 GGCGCGCGCCGGGGCGCGGGCGG - Intronic
994209748 5:97074179-97074201 GGCGCCCGCCACCACGCCCGGGG - Intergenic
1002611440 5:180421124-180421146 GGCGCCTACCACTCAGCGGGAGG + Intergenic
1002709140 5:181183657-181183679 GGCGCCCGCCACCGCGCCTGTGG - Intergenic
1002991863 6:2245726-2245748 GCCGACGGCCACCGCGCGGGAGG + Intergenic
1003260651 6:4512501-4512523 ACCGCCCGCCACCGCGCGTGTGG - Intergenic
1006404446 6:33836115-33836137 TGCGCCCGCTACTGCGCTTGGGG + Intergenic
1013213335 6:108005758-108005780 GGCGCCCGCCACTGCCAGGATGG + Intergenic
1014802260 6:125790659-125790681 AGCGCGCGCCACTGGCCGGGAGG + Intronic
1015244794 6:131063381-131063403 AGGCCCCGCCCCTGCGCGGGCGG + Intergenic
1016340932 6:143060847-143060869 GGCGCCCGCCCCCGCGCGCCCGG + Intronic
1017671983 6:156777762-156777784 GGCGCCGGCCGCGGCCCGGGGGG - Intergenic
1019112231 6:169724913-169724935 GGCGCCCGCCCCGGAGCGTGCGG + Intronic
1019644419 7:2121410-2121432 CGTGCCTGCCACTGCCCGGGAGG - Intronic
1020020260 7:4862105-4862127 GGCTCCTACCGCTGCGCGGGGGG + Intronic
1022101991 7:27174342-27174364 GGCGCCCGCCGCGGTGCGGGGGG - Intronic
1023089094 7:36601058-36601080 GGCGCACACCACTGCTCTGGAGG + Intronic
1023181744 7:37492015-37492037 GCAGCCCGCCACTGCGCTGTCGG + Intergenic
1025102968 7:56150784-56150806 GGCGCCCCTCACTGGCCGGGCGG - Intergenic
1025256242 7:57385549-57385571 GGCCCCCGCCACAGCTGGGGCGG + Intergenic
1026008077 7:66614900-66614922 GGCGCCCGCCACCTCCCGGACGG - Intergenic
1037547562 8:19939499-19939521 GGCGGCCACCCCTCCGCGGGAGG - Exonic
1040003659 8:42600139-42600161 GGTGCCCACCACAGGGCGGGGGG + Intergenic
1042591848 8:70403964-70403986 GGCGGCGGCCACTGCCGGGGAGG - Intergenic
1045195695 8:99927437-99927459 GGCGCCCCCCACCTCCCGGGCGG - Intergenic
1046031462 8:108787606-108787628 AGCGCCCGCCACGGCGGGCGGGG + Exonic
1049457335 8:142700394-142700416 GGCGCGCGCCCCGGGGCGGGCGG + Exonic
1049457632 8:142701469-142701491 GGCCCCAGCCACTGCTCAGGGGG + Intronic
1049707441 8:144049414-144049436 GGCGGGCGCCAGAGCGCGGGCGG - Intergenic
1054906632 9:70419099-70419121 GTCGCCCGCCAGTCCGCGGCCGG - Intergenic
1055586120 9:77761179-77761201 GGCGCCCCTCACTGGCCGGGCGG - Intronic
1057592302 9:96383384-96383406 GGCGCCCGGGACAGGGCGGGTGG - Intronic
1058045400 9:100352586-100352608 TGCGGCCGGCACTGCGGGGGCGG - Intronic
1058908090 9:109497901-109497923 TGCGCCCGCCCCTGCCCGGCTGG + Intronic
1060114383 9:120928928-120928950 GGCGCCCGCGGCTGGGCTGGGGG + Intronic
1062047060 9:134429207-134429229 GGCGCCCACCCCTGCGCTGTGGG - Exonic
1062446689 9:136598224-136598246 TGGGCCCGCCATTGCGCTGGGGG + Intergenic
1187163914 X:16787149-16787171 GCTCCCCGCCACTGCGCGGGCGG + Intronic
1188004081 X:25005484-25005506 GGCGGCCGCGGCGGCGCGGGTGG - Intronic
1188443991 X:30237844-30237866 GGCGCCCGCCACTGCGTGAGAGG - Intergenic
1189262621 X:39689141-39689163 GGTCCCCGCCACAGCCCGGGAGG - Intergenic
1189406381 X:40728960-40728982 GGCGCCCGCCACTATGCCCGTGG + Intronic
1189534507 X:41923166-41923188 GGCGACCGCCCCGGCGCGGGCGG + Intronic