ID: 937408138

View in Genome Browser
Species Human (GRCh38)
Location 2:121649360-121649382
Sequence AAAACAGGGCTGTAAGTACC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937408138_937408141 -2 Left 937408138 2:121649360-121649382 CCGGGTACTTACAGCCCTGTTTT 0: 1
1: 0
2: 0
3: 15
4: 133
Right 937408141 2:121649381-121649403 TTTCGTTACTGTTGCCGCTGCGG 0: 1
1: 0
2: 0
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937408138 Original CRISPR AAAACAGGGCTGTAAGTACC CGG (reversed) Exonic
902175028 1:14643011-14643033 AACACAGGGGTTTATGTACCCGG - Intronic
902792211 1:18777036-18777058 AAACCAGGCATTTAAGTACCTGG - Intergenic
906830498 1:49026421-49026443 AAAATAGGGCAGGAAATACCAGG + Intronic
906926889 1:50127340-50127362 AATATAGGGTGGTAAGTACCAGG + Intronic
907289305 1:53402664-53402686 AAAACTAGGCTGTCAGTTCCAGG + Intergenic
913149391 1:116025674-116025696 GACACAGAGCTGTAAGTAGCAGG - Intronic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
915689938 1:157678838-157678860 AATAGAGGACTGTAAGTTCCTGG + Exonic
921189440 1:212696820-212696842 AACACTGGGCTGGAAGGACCTGG + Intronic
1063531990 10:6842199-6842221 AACACTGGACTGTGAGTACCAGG - Intergenic
1066346398 10:34591034-34591056 GAAACAGGGCGGGAAGTAACAGG + Intronic
1067479916 10:46587912-46587934 AAATCAGGGCTGTGAGGACCAGG - Intronic
1067614821 10:47753885-47753907 AAATCAGGGCTGTGAGGACCAGG + Intergenic
1067685535 10:48464389-48464411 AAAACAGGGATGGAAGAGCCAGG + Intronic
1067943535 10:50676468-50676490 AGAAGAGGGCTGCATGTACCTGG + Intergenic
1069121647 10:64576285-64576307 AAAGCAGGGCTATAAAGACCTGG - Intergenic
1071630227 10:87213848-87213870 AAATCAGGGCTGTGAGGACCAGG + Intergenic
1075021573 10:118956320-118956342 AAGATAAGGCTGTAAGTGCCAGG + Intergenic
1075758254 10:124833500-124833522 AAAACACGGCTGACATTACCTGG - Intronic
1079180407 11:18188897-18188919 AAAAAAGGGCTGTGACTGCCCGG + Exonic
1083812462 11:65113230-65113252 CCAACAGGGCTGTCAGCACCAGG - Exonic
1084176176 11:67423548-67423570 AGAGCAGGGCTGTGAGCACCAGG - Exonic
1085579706 11:77639378-77639400 ACAACAGGGTTGTATGTAACTGG - Intergenic
1094684817 12:32700906-32700928 AAAACAGGGCTGTTATTTTCTGG + Intronic
1096717985 12:53502333-53502355 AGAACAGGGCTGTAAGAAGGTGG + Intronic
1097381879 12:58905046-58905068 AACACAGGGCTGGAACAACCTGG + Intronic
1098320859 12:69241393-69241415 AAAAGAGGGCTGTAACTGCAAGG + Intronic
1101031631 12:100666688-100666710 AAAACAGGGCTTCAAGGACCAGG - Intergenic
1103077206 12:117993618-117993640 GAAGCATGGCGGTAAGTACCAGG - Intergenic
1108666828 13:52641136-52641158 AAGACATGGCTGTCAGTACTTGG + Exonic
1109008461 13:56909439-56909461 AAAACAGGGCTTCCAGTTCCAGG + Intergenic
1111381957 13:87467427-87467449 AAAAGTTGGCTGTAATTACCTGG - Intergenic
1112970095 13:105251211-105251233 AAAACAGGGATGTAACTACAAGG + Intergenic
1113514986 13:110887451-110887473 AAAACAGGACTGTAATTGCCAGG + Intronic
1114228022 14:20756344-20756366 AAAACAAGGCTGAAAACACCTGG + Intergenic
1116617045 14:47153366-47153388 AAAAAAGGTCTCTAAGGACCTGG + Intronic
1119641140 14:76315818-76315840 TAAACAGTGCTGTAAGGTCCTGG - Intronic
1121503079 14:94454343-94454365 ATAACTGGGCTGTAAGTATTTGG + Intergenic
1121798051 14:96752062-96752084 AAAAAGGGGCAGCAAGTACCTGG + Intergenic
1122283595 14:100638421-100638443 AAGACAGGGCTGTTGGTACCCGG - Intergenic
1124812229 15:32952668-32952690 AGTACAGAGCTGCAAGTACCAGG - Intronic
1125614934 15:41002472-41002494 AAAACTGGGCTGTGAGACCCAGG - Intronic
1126226508 15:46276794-46276816 AGACCAAGGCTGTAAATACCTGG + Intergenic
1126960864 15:53992591-53992613 AAAACAGGACTGTGAGTCACGGG - Intergenic
1127669083 15:61177505-61177527 AAAATACGGCTGTCAGCACCAGG + Intronic
1128599501 15:68983868-68983890 AAGCCAGGGGTGTAAGTACCTGG + Intronic
1128646016 15:69379541-69379563 AAAACTGGGCTGTAGGCCCCAGG + Intronic
1129343796 15:74903846-74903868 AAAACAGGGATGTAAAATCCTGG - Intronic
1132220193 15:100099614-100099636 AAAGCAGGGCTTCAAGTTCCTGG + Intronic
1144791584 17:17862591-17862613 AAAGCATGGCTGTAAGGACTTGG - Intronic
1148080792 17:44966932-44966954 CAGCCAGGGCTGTAAGCACCGGG + Intronic
1151750320 17:76033444-76033466 AAAATAGGGCTGCAGGTCCCCGG - Intergenic
1152934453 17:83127901-83127923 AACACAGGGCCTTAAGAACCTGG - Intergenic
1154999518 18:21673172-21673194 CAAACAGGGCTGAAAATCCCTGG - Intronic
1155402164 18:25450820-25450842 AAAACGGTTCTGGAAGTACCAGG - Intergenic
1156646423 18:39167191-39167213 GAGACAGGCCTGTAAGTACTGGG - Intergenic
1156834393 18:41535231-41535253 AAGACAGGGCTGTAAGCAGTAGG - Intergenic
1157112818 18:44836904-44836926 AAAATAGGGATGTAAGTGACAGG - Intronic
1164806254 19:31119354-31119376 AAAGGAGGGCTGTTACTACCGGG + Intergenic
925855172 2:8122614-8122636 AAAACAGGGCTGTGAATGTCTGG - Intergenic
928303256 2:30146016-30146038 CTAACAGAGATGTAAGTACCTGG + Intergenic
928440283 2:31286470-31286492 ATAACAGGGCTGTCATTAACTGG - Intergenic
929941344 2:46336298-46336320 ATAACTGTGCTGTAAGTACCAGG - Intronic
931623990 2:64238875-64238897 AAAACATGGCTGTCAGAGCCTGG - Intergenic
931844593 2:66190258-66190280 AAAACAGAGCTGTGAGTTCATGG + Intergenic
932130165 2:69180268-69180290 AAAACAAGGCTGTGAGAAGCAGG + Intronic
932723941 2:74161295-74161317 AAAACATGCCTGTAAGCTCCAGG - Intronic
935602009 2:104932275-104932297 AAAACAAGGCAGGAAGTTCCAGG + Intergenic
937408138 2:121649360-121649382 AAAACAGGGCTGTAAGTACCCGG - Exonic
940806900 2:158197722-158197744 AAAATAGGGAAGTAATTACCAGG - Intronic
941276079 2:163492222-163492244 AATACACGGCTGTAATTACTTGG + Intergenic
945554323 2:211260774-211260796 GAAGGAGGTCTGTAAGTACCTGG - Intergenic
945702645 2:213190801-213190823 CAAACATAGCTGTAAGTCCCTGG + Intergenic
945738098 2:213626341-213626363 AAAACAAAACTGTAAATACCCGG + Intronic
945994672 2:216425877-216425899 AAAACCAGGCTGTCAGTTCCAGG - Intronic
1170802729 20:19603784-19603806 AAAACAAGGCTGTGAGTTCCAGG + Intronic
1173199313 20:40943068-40943090 AAAACATGGCAATAACTACCTGG + Intergenic
1175011379 20:55740915-55740937 ATCACTGGGCTGTATGTACCAGG + Intergenic
1175074661 20:56362436-56362458 GAAACATTGCCGTAAGTACCCGG - Intronic
1175521990 20:59607892-59607914 ACAACACAGCTGTAATTACCTGG + Intronic
1178134696 21:29614189-29614211 GAAGGAGGCCTGTAAGTACCAGG + Intronic
1178660237 21:34501702-34501724 AAAACAAAGCTCTAAGTACATGG + Intergenic
1182898257 22:33876220-33876242 AAAACAGGACTGAAACTAACTGG + Intronic
1183498501 22:38164008-38164030 GAAACAGGGCTGTACCTCCCAGG - Intronic
1183949711 22:41346013-41346035 CAAGCAGGACTGTAAGTACGGGG + Exonic
1185019037 22:48362870-48362892 AACACAGCGCTCTGAGTACCAGG - Intergenic
952249451 3:31636740-31636762 AAATCTGCTCTGTAAGTACCTGG - Exonic
953147453 3:40291508-40291530 AAAACTGGGCTGCCAGTTCCAGG - Intergenic
953194744 3:40721758-40721780 AAGCCAGGGCAGTAAGCACCGGG - Intergenic
961447145 3:126986143-126986165 AAAGCAGGCCTGCAATTACCAGG - Intergenic
962406218 3:135102546-135102568 AAAACAAGGGTGAAAGTGCCAGG - Intronic
963643431 3:147884219-147884241 AAAACAGAGCTGCCAGTTCCAGG - Intergenic
963864499 3:150345439-150345461 AAAACAGTACTGTACGTGCCAGG - Intergenic
964111087 3:153088373-153088395 GAAGCAGGGCTGTCAGCACCAGG - Intergenic
964333863 3:155634215-155634237 AAAAGAGGGCTGTAAGAGCCTGG + Intronic
965517528 3:169637487-169637509 ACAACTTGGCTGTAAGTTCCTGG - Intronic
965604233 3:170483538-170483560 AAGACAGGGCTGGAGGTACAGGG + Intronic
970051717 4:11922060-11922082 GAAACAGGGGTGTAAAGACCCGG + Intergenic
970450209 4:16158654-16158676 CACACAGGGCTGTAATTGCCGGG + Intergenic
971754197 4:30686109-30686131 AAAACAAGGATGTAAGAACCAGG - Intergenic
974324671 4:60398320-60398342 AAAACAGGACTGTATGAAACTGG + Intergenic
979724259 4:123942008-123942030 AAAACCGGGCTGCCAGTTCCAGG + Intergenic
979726441 4:123968091-123968113 AAATCAGGGCTATAAGTAAAGGG - Intergenic
979915137 4:126421828-126421850 AAAACAGTGCTGTATGTATGTGG - Intergenic
981566568 4:146107846-146107868 AAAACAGAGCAGTATCTACCTGG - Intergenic
981957931 4:150501999-150502021 AAAACAGAGCTTGAAGTACAGGG + Intronic
985011625 4:185588518-185588540 AAACCAAGGCAGTAAGTGCCAGG - Intronic
987637038 5:20556622-20556644 AAAAAAGGTCTGTAAATATCTGG - Intronic
988606313 5:32681260-32681282 TGAACAAGGCTGTAAGTACATGG + Intergenic
992897358 5:81256847-81256869 CAAACAGGACTGCAAGTGCCAGG - Intronic
994830124 5:104771456-104771478 AAACCAGAGCTGTGATTACCTGG - Intergenic
994874139 5:105393113-105393135 AAAACCGGGCTGCCAGTTCCAGG - Intergenic
996255111 5:121391271-121391293 AAAACAGAGCAGTATATACCAGG + Intergenic
999301500 5:150493607-150493629 AAAACAGGGTGGTGAGAACCTGG - Intronic
999580785 5:153036542-153036564 AAAACAGGCCTGTAAGGAGGTGG + Intergenic
1003675970 6:8204618-8204640 AAGACAGGGCTGGAAGTATGTGG - Intergenic
1005532330 6:26720607-26720629 AAAACAGGGAAATAAGGACCTGG - Intergenic
1005538465 6:26781058-26781080 AAAACAGGGAAATAAGGACCTGG + Intergenic
1007232166 6:40355946-40355968 AAGACAGGGCTGGCAGTACTGGG - Intergenic
1008086595 6:47251811-47251833 AAAACTAGGCTTTAAGTAGCTGG - Intronic
1020506451 7:8995018-8995040 AAGCCAGAGCTGTAAGTAACTGG - Intergenic
1021390385 7:20085849-20085871 TAAACAGGGCTGTAACTCACAGG + Intergenic
1021758661 7:23881668-23881690 TAAACAGGGATTTAAGTTCCTGG + Intergenic
1022692980 7:32676221-32676243 AAAACAGGGCTGCAAATTCACGG + Intergenic
1032794209 7:135264467-135264489 AAAACTGGGCTGCCAGTTCCAGG - Intergenic
1032976201 7:137226200-137226222 AAAACAGTCCTATAAGTAACTGG - Intergenic
1038941938 8:32314769-32314791 GAAACAAGGCTGTAAGGACAGGG - Intronic
1039150993 8:34505268-34505290 AAAACAGGGATGTCAGTCACAGG + Intergenic
1045614403 8:103891620-103891642 AAAAAAGGCCTGCAACTACCAGG - Intronic
1047354908 8:124111355-124111377 AAAGCAGGGCTTTCAGGACCAGG - Intronic
1049047501 8:140164602-140164624 GAGACATGGCTGTTAGTACCAGG - Intronic
1050318159 9:4424399-4424421 AGAATAGGCCTGTAAGTACCAGG + Intergenic
1055998316 9:82186586-82186608 GAAAGAGTGCTATAAGTACCTGG + Intergenic
1059334564 9:113560699-113560721 AAACCAGGGCTGTGAGCCCCAGG + Intronic
1061499636 9:130994394-130994416 AACACAAGGCTGTAAGCACCAGG - Intergenic
1062674521 9:137732663-137732685 AAAACCGGGCTGCCAGTTCCCGG - Intronic
1189557295 X:42158410-42158432 AAAACACGGCTGAAAGAAACCGG - Intergenic
1190044547 X:47101495-47101517 TAAACTGGGCCGTAAGTCCCTGG - Intergenic
1190140071 X:47835434-47835456 AAAGCAGGGCTGTATGTAAAGGG - Intergenic
1190458844 X:50650982-50651004 AGACCAGGGCTGGAAGAACCAGG + Intronic
1194697453 X:97072024-97072046 AAAACAGGGTTGTAAGTAATGGG - Intronic
1195129931 X:101841566-101841588 AAGGCAGGGTGGTAAGTACCAGG + Intronic
1195176293 X:102318218-102318240 AAGGCAGGGTGGTAAGTACCAGG - Intronic
1195182571 X:102368875-102368897 AAGGCAGGGTGGTAAGTACCAGG + Intronic
1196111730 X:111953772-111953794 AAAGCAGGGATGTCATTACCTGG - Intronic
1199057077 X:143309219-143309241 AAAACAGGACTTAAAGTTCCAGG - Intergenic
1200280032 X:154769300-154769322 AAGACAGTGCAGTAAGTTCCGGG + Exonic
1200283674 X:154800543-154800565 AACACAGGGCTGCAGATACCTGG + Intronic
1201748015 Y:17402100-17402122 AAAACAGGGCTGGAAGCTCGGGG + Intergenic