ID: 937408138

View in Genome Browser
Species Human (GRCh38)
Location 2:121649360-121649382
Sequence AAAACAGGGCTGTAAGTACC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937408138_937408141 -2 Left 937408138 2:121649360-121649382 CCGGGTACTTACAGCCCTGTTTT 0: 1
1: 0
2: 0
3: 15
4: 133
Right 937408141 2:121649381-121649403 TTTCGTTACTGTTGCCGCTGCGG 0: 1
1: 0
2: 0
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937408138 Original CRISPR AAAACAGGGCTGTAAGTACC CGG (reversed) Exonic