ID: 937408737

View in Genome Browser
Species Human (GRCh38)
Location 2:121654200-121654222
Sequence ATGGAGGAGCAGGTTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937408728_937408737 24 Left 937408728 2:121654153-121654175 CCTGAGCATTTTGAAGAATGGTG No data
Right 937408737 2:121654200-121654222 ATGGAGGAGCAGGTTGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937408737 Original CRISPR ATGGAGGAGCAGGTTGGGGA TGG Intergenic
No off target data available for this crispr