ID: 937411917

View in Genome Browser
Species Human (GRCh38)
Location 2:121683960-121683982
Sequence GGGATGGAATTTTCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937411917_937411922 19 Left 937411917 2:121683960-121683982 CCCACAGTGGAAAATTCCATCCC No data
Right 937411922 2:121684002-121684024 AGAAATAAATCAATGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937411917 Original CRISPR GGGATGGAATTTTCCACTGT GGG (reversed) Intergenic