ID: 937413965

View in Genome Browser
Species Human (GRCh38)
Location 2:121699684-121699706
Sequence CTTGCAAGGCTGAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937413965_937413974 6 Left 937413965 2:121699684-121699706 CCCACCTCCCTCAGCCTTGCAAG No data
Right 937413974 2:121699713-121699735 GCTCTTGCTTTCATTTCACAGGG No data
937413965_937413973 5 Left 937413965 2:121699684-121699706 CCCACCTCCCTCAGCCTTGCAAG No data
Right 937413973 2:121699712-121699734 GGCTCTTGCTTTCATTTCACAGG No data
937413965_937413975 16 Left 937413965 2:121699684-121699706 CCCACCTCCCTCAGCCTTGCAAG No data
Right 937413975 2:121699723-121699745 TCATTTCACAGGGAAGCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937413965 Original CRISPR CTTGCAAGGCTGAGGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr