ID: 937413965 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:121699684-121699706 |
| Sequence | CTTGCAAGGCTGAGGGAGGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 937413965_937413974 | 6 | Left | 937413965 | 2:121699684-121699706 | CCCACCTCCCTCAGCCTTGCAAG | No data | ||
| Right | 937413974 | 2:121699713-121699735 | GCTCTTGCTTTCATTTCACAGGG | No data | ||||
| 937413965_937413973 | 5 | Left | 937413965 | 2:121699684-121699706 | CCCACCTCCCTCAGCCTTGCAAG | No data | ||
| Right | 937413973 | 2:121699712-121699734 | GGCTCTTGCTTTCATTTCACAGG | No data | ||||
| 937413965_937413975 | 16 | Left | 937413965 | 2:121699684-121699706 | CCCACCTCCCTCAGCCTTGCAAG | No data | ||
| Right | 937413975 | 2:121699723-121699745 | TCATTTCACAGGGAAGCTAACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 937413965 | Original CRISPR | CTTGCAAGGCTGAGGGAGGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||