ID: 937414050

View in Genome Browser
Species Human (GRCh38)
Location 2:121700174-121700196
Sequence TGAGGTCCAGGGCGTTGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937414050_937414062 28 Left 937414050 2:121700174-121700196 CCGGATCAACGCCCTGGACCTCA No data
Right 937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG No data
937414050_937414054 -10 Left 937414050 2:121700174-121700196 CCGGATCAACGCCCTGGACCTCA No data
Right 937414054 2:121700187-121700209 CTGGACCTCACCTGGCAGTGAGG No data
937414050_937414058 0 Left 937414050 2:121700174-121700196 CCGGATCAACGCCCTGGACCTCA No data
Right 937414058 2:121700197-121700219 CCTGGCAGTGAGGAACCAGTGGG No data
937414050_937414061 18 Left 937414050 2:121700174-121700196 CCGGATCAACGCCCTGGACCTCA No data
Right 937414061 2:121700215-121700237 GTGGGAAGAGAGGTGCGTGCTGG No data
937414050_937414059 8 Left 937414050 2:121700174-121700196 CCGGATCAACGCCCTGGACCTCA No data
Right 937414059 2:121700205-121700227 TGAGGAACCAGTGGGAAGAGAGG No data
937414050_937414056 -1 Left 937414050 2:121700174-121700196 CCGGATCAACGCCCTGGACCTCA No data
Right 937414056 2:121700196-121700218 ACCTGGCAGTGAGGAACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937414050 Original CRISPR TGAGGTCCAGGGCGTTGATC CGG (reversed) Intergenic
No off target data available for this crispr