ID: 937414052

View in Genome Browser
Species Human (GRCh38)
Location 2:121700185-121700207
Sequence TCACTGCCAGGTGAGGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937414052_937414062 17 Left 937414052 2:121700185-121700207 CCCTGGACCTCACCTGGCAGTGA No data
Right 937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG No data
937414052_937414059 -3 Left 937414052 2:121700185-121700207 CCCTGGACCTCACCTGGCAGTGA No data
Right 937414059 2:121700205-121700227 TGAGGAACCAGTGGGAAGAGAGG No data
937414052_937414061 7 Left 937414052 2:121700185-121700207 CCCTGGACCTCACCTGGCAGTGA No data
Right 937414061 2:121700215-121700237 GTGGGAAGAGAGGTGCGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937414052 Original CRISPR TCACTGCCAGGTGAGGTCCA GGG (reversed) Intergenic
No off target data available for this crispr