ID: 937414055

View in Genome Browser
Species Human (GRCh38)
Location 2:121700192-121700214
Sequence TGGTTCCTCACTGCCAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937414055_937414061 0 Left 937414055 2:121700192-121700214 CCTCACCTGGCAGTGAGGAACCA No data
Right 937414061 2:121700215-121700237 GTGGGAAGAGAGGTGCGTGCTGG No data
937414055_937414062 10 Left 937414055 2:121700192-121700214 CCTCACCTGGCAGTGAGGAACCA No data
Right 937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG No data
937414055_937414064 29 Left 937414055 2:121700192-121700214 CCTCACCTGGCAGTGAGGAACCA No data
Right 937414064 2:121700244-121700266 CTGGACAGCACGTAGTCTCTCGG No data
937414055_937414059 -10 Left 937414055 2:121700192-121700214 CCTCACCTGGCAGTGAGGAACCA No data
Right 937414059 2:121700205-121700227 TGAGGAACCAGTGGGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937414055 Original CRISPR TGGTTCCTCACTGCCAGGTG AGG (reversed) Intergenic
No off target data available for this crispr