ID: 937414057

View in Genome Browser
Species Human (GRCh38)
Location 2:121700197-121700219
Sequence CCCACTGGTTCCTCACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937414057_937414064 24 Left 937414057 2:121700197-121700219 CCTGGCAGTGAGGAACCAGTGGG No data
Right 937414064 2:121700244-121700266 CTGGACAGCACGTAGTCTCTCGG No data
937414057_937414061 -5 Left 937414057 2:121700197-121700219 CCTGGCAGTGAGGAACCAGTGGG No data
Right 937414061 2:121700215-121700237 GTGGGAAGAGAGGTGCGTGCTGG No data
937414057_937414065 27 Left 937414057 2:121700197-121700219 CCTGGCAGTGAGGAACCAGTGGG No data
Right 937414065 2:121700247-121700269 GACAGCACGTAGTCTCTCGGTGG No data
937414057_937414062 5 Left 937414057 2:121700197-121700219 CCTGGCAGTGAGGAACCAGTGGG No data
Right 937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937414057 Original CRISPR CCCACTGGTTCCTCACTGCC AGG (reversed) Intergenic
No off target data available for this crispr