ID: 937414060

View in Genome Browser
Species Human (GRCh38)
Location 2:121700212-121700234
Sequence GCACGCACCTCTCTTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937414060_937414065 12 Left 937414060 2:121700212-121700234 CCAGTGGGAAGAGAGGTGCGTGC No data
Right 937414065 2:121700247-121700269 GACAGCACGTAGTCTCTCGGTGG No data
937414060_937414064 9 Left 937414060 2:121700212-121700234 CCAGTGGGAAGAGAGGTGCGTGC No data
Right 937414064 2:121700244-121700266 CTGGACAGCACGTAGTCTCTCGG No data
937414060_937414062 -10 Left 937414060 2:121700212-121700234 CCAGTGGGAAGAGAGGTGCGTGC No data
Right 937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937414060 Original CRISPR GCACGCACCTCTCTTCCCAC TGG (reversed) Intergenic
No off target data available for this crispr