ID: 937414062

View in Genome Browser
Species Human (GRCh38)
Location 2:121700225-121700247
Sequence AGGTGCGTGCTGGACTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937414050_937414062 28 Left 937414050 2:121700174-121700196 CCGGATCAACGCCCTGGACCTCA No data
Right 937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG No data
937414053_937414062 16 Left 937414053 2:121700186-121700208 CCTGGACCTCACCTGGCAGTGAG No data
Right 937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG No data
937414055_937414062 10 Left 937414055 2:121700192-121700214 CCTCACCTGGCAGTGAGGAACCA No data
Right 937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG No data
937414057_937414062 5 Left 937414057 2:121700197-121700219 CCTGGCAGTGAGGAACCAGTGGG No data
Right 937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG No data
937414060_937414062 -10 Left 937414060 2:121700212-121700234 CCAGTGGGAAGAGAGGTGCGTGC No data
Right 937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG No data
937414052_937414062 17 Left 937414052 2:121700185-121700207 CCCTGGACCTCACCTGGCAGTGA No data
Right 937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937414062 Original CRISPR AGGTGCGTGCTGGACTCCAC TGG Intergenic
No off target data available for this crispr