ID: 937419700

View in Genome Browser
Species Human (GRCh38)
Location 2:121743496-121743518
Sequence TGCCAGTGGTCTTGGCGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937419693_937419700 5 Left 937419693 2:121743468-121743490 CCTGGACAGACCACAGTATTGCC 0: 1
1: 0
2: 0
3: 10
4: 101
Right 937419700 2:121743496-121743518 TGCCAGTGGTCTTGGCGTGCTGG 0: 1
1: 0
2: 5
3: 18
4: 99
937419694_937419700 -5 Left 937419694 2:121743478-121743500 CCACAGTATTGCCCCAGCTGCCA 0: 1
1: 0
2: 0
3: 18
4: 208
Right 937419700 2:121743496-121743518 TGCCAGTGGTCTTGGCGTGCTGG 0: 1
1: 0
2: 5
3: 18
4: 99
937419691_937419700 23 Left 937419691 2:121743450-121743472 CCTACAGACTTATTTCTTCCTGG No data
Right 937419700 2:121743496-121743518 TGCCAGTGGTCTTGGCGTGCTGG 0: 1
1: 0
2: 5
3: 18
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937419700 Original CRISPR TGCCAGTGGTCTTGGCGTGC TGG Intronic
901883445 1:12207182-12207204 TGCCTCTGCTCTTGGCCTGCAGG - Exonic
903639429 1:24848389-24848411 TGCCAGCGGTCTGGGTGTGACGG + Intergenic
903947150 1:26971205-26971227 TGCCAGAGGTCATGGGGTGATGG + Intergenic
905800519 1:40839516-40839538 TGCCAGTGGACTGGCCTTGCAGG + Exonic
907519068 1:55011500-55011522 TCCCAGTGGTCTTTGGCTGCAGG - Intergenic
912675795 1:111679640-111679662 AGCCAGTGATCTTAGCTTGCTGG - Intronic
916734100 1:167591787-167591809 AGCCAGTGGTCTTGGCATGCTGG - Intergenic
922661098 1:227430921-227430943 AGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1066329894 10:34409582-34409604 TGCCAGTGTTCCTGGCATGGTGG - Intronic
1070164582 10:73888022-73888044 TGCTAGTGGTCTGGGCATGCAGG - Intergenic
1070827751 10:79401116-79401138 AGCCTGGAGTCTTGGCGTGCAGG - Intronic
1071736253 10:88303841-88303863 TGGAAGTGGTCTTGGCCTGGGGG - Intronic
1074783083 10:116816158-116816180 AGCCAGTGGTCTTTGCGTGAGGG - Intergenic
1077546355 11:3171976-3171998 TGCCATTGGTTTTGGTGAGCCGG + Intergenic
1077885278 11:6382787-6382809 TTCCAGTTGTCTTGCCTTGCTGG + Intergenic
1078093773 11:8283956-8283978 TGCCAGAGGTCTGGACATGCCGG - Intergenic
1080715052 11:34792202-34792224 TGCCAGAGGTCCTGGAGTGAAGG - Intergenic
1082166176 11:48954177-48954199 TGCCAGTGCCCTTGGGATGCTGG + Intergenic
1083401007 11:62423594-62423616 TGCCTGTGGACTTGGAGTGAAGG - Intergenic
1083591075 11:63895263-63895285 TGCCAATGGTCTTGAGGAGCCGG - Exonic
1085992202 11:81863009-81863031 TCCCAGTTGTCTTGGCATGGTGG + Intergenic
1087791749 11:102413400-102413422 TGCCAGTGGTGATGGGGTGGTGG - Intronic
1089262335 11:117231906-117231928 TGCCTGAGGTCCTGGCGTGGGGG - Intronic
1089536049 11:119161366-119161388 TCCCAGTAGTCTTTGCATGCAGG - Exonic
1089610497 11:119666021-119666043 TGGCTGTGGTCTGGGCCTGCAGG + Intronic
1091918017 12:4283030-4283052 TGGCCGAGGTCTTGGGGTGCAGG - Intronic
1092096037 12:5842553-5842575 ACCCAGTGGTGGTGGCGTGCTGG - Intronic
1092194618 12:6541717-6541739 AGCCACTGCTCTTGGCGTGTTGG - Intronic
1095049185 12:37541816-37541838 TGCCAGTGGTCTTGTCATCCTGG - Intergenic
1098072390 12:66689825-66689847 TGCCAGAGGTCTGGGAGTGGGGG - Intronic
1104141809 12:125994594-125994616 TGCCAGTGGTCTTTCTGTTCTGG + Intergenic
1104305531 12:127607536-127607558 TGACAATGGTCTGGGCGTGGGGG + Intergenic
1105663210 13:22522553-22522575 TGCCATTGGTTTTGGCGTTTTGG + Intergenic
1112183395 13:97106483-97106505 GGCCAGTGGCCTTGGCATGGGGG - Intergenic
1113928179 13:113952605-113952627 GGCCAGTGGTCCTGGGGTGGTGG - Intergenic
1114215565 14:20655426-20655448 TCCCAGTGGTCTTGGGGTAGTGG - Intergenic
1115183524 14:30657100-30657122 TGCCAGTGGTGTTGGTGTTAAGG + Intronic
1120839878 14:89076114-89076136 TGCCAGTGGTTCTTGCGTTCTGG + Intergenic
1122636584 14:103132472-103132494 TGGCAGTGGACTTGGCCTCCGGG + Intronic
1126700973 15:51367318-51367340 TGCCAGAGACATTGGCGTGCAGG + Intronic
1132470656 16:101131-101153 TGCCAGGGGTCTGGACGGGCAGG - Intronic
1132826700 16:1908806-1908828 TGCCAGTGTGGTGGGCGTGCTGG + Intergenic
1133982964 16:10647180-10647202 TGCCAGTGGGCTGGGCGCGGTGG + Intronic
1135462826 16:22659932-22659954 TGCCAGGGGTCTTTGCAAGCTGG + Intergenic
1137036762 16:35574958-35574980 TGCCAGTGGTTGGGGCCTGCAGG - Intergenic
1140474918 16:75235017-75235039 TGTCAGTGGGGTTGGGGTGCAGG + Exonic
1142675609 17:1511514-1511536 TGCCAGGGCTCGTGGCCTGCAGG - Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1161337230 19:3721246-3721268 TTCCTGCGGTCTTGGCCTGCGGG - Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
926207101 2:10841579-10841601 TGCCAGTGGGGCTGGTGTGCAGG - Intergenic
927212282 2:20646247-20646269 TGCCAGAGGTGTTTGCGTGAGGG - Intronic
928114615 2:28538213-28538235 TGCCTGTGGTCTTGCCTGGCAGG + Intronic
928767896 2:34670285-34670307 AGCCGGTGGACTTGGGGTGCAGG + Intergenic
929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG + Intronic
932897299 2:75653311-75653333 TGACAGTGGGCTGTGCGTGCAGG + Intronic
937419700 2:121743496-121743518 TGCCAGTGGTCTTGGCGTGCTGG + Intronic
938380693 2:130834997-130835019 TGGCAGGGATCTGGGCGTGCGGG + Intergenic
938992782 2:136646469-136646491 TGTCAGTGGTGGTGGCCTGCAGG - Intergenic
944754245 2:202743147-202743169 TGGCAGTGGGCCTGGTGTGCTGG - Intronic
946003122 2:216499362-216499384 AGCAAGTGTACTTGGCGTGCTGG - Exonic
948110245 2:235449078-235449100 TGTCAGTGCTCTTGGCTTGCAGG + Intergenic
1168988176 20:2069301-2069323 TGCCAGTAGACTTGCCTTGCAGG + Intergenic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1170167904 20:13380987-13381009 AACCAGTGGTCTTAGCTTGCTGG + Intergenic
1170984276 20:21243688-21243710 TGCTAGTGTTCGTGGCGTCCAGG - Intronic
1172394099 20:34587098-34587120 TGCCAGTGCTGTTGGCCTGCTGG - Intronic
1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG + Intronic
1174506432 20:51020666-51020688 TGCCAGAGGTCTAGGGGTACAGG - Intronic
1175243138 20:57564403-57564425 TGCCAGAGGCCTTGGTGTGCCGG + Intronic
1176649337 21:9530841-9530863 TGCCAGTGGCATTGGCGAGCTGG + Intergenic
1177670929 21:24226066-24226088 TGCCAGTGGCCAAGGTGTGCGGG - Intergenic
1179610631 21:42547858-42547880 TGCCAGTGGACATGGGGAGCGGG - Intronic
1180056100 21:45359948-45359970 TGCAGGTGGTCTTGGTGTCCAGG + Intergenic
1180142473 21:45900707-45900729 TGCCTGTGCTCTTGGCCAGCCGG + Intronic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
953217165 3:40930425-40930447 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
960840970 3:121958198-121958220 AGCCAGTGGACTTGGGGGGCAGG + Intergenic
961544547 3:127623291-127623313 GTCCAGTGGTCTTGGAGAGCTGG + Intergenic
961714250 3:128847818-128847840 TGCCACTGGGCTGGGTGTGCTGG + Intergenic
964151596 3:153532015-153532037 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
967637289 3:191818152-191818174 TGACAATGGTCCTGGCTTGCTGG - Intergenic
969395901 4:6921111-6921133 TGCCAGTGTTCTCAGTGTGCTGG + Intronic
991950074 5:71938941-71938963 TGCATGTGGGCTTGGCTTGCAGG + Intergenic
995695736 5:114876449-114876471 AGCCAGTGATCTTAGCTTGCTGG - Intergenic
996292228 5:121865960-121865982 TGCCAGTGGTCTGGGTGTCTGGG - Intergenic
1000634673 5:163630438-163630460 TGACAGTGGGCTGGGCGTGGTGG - Intergenic
1005810741 6:29513926-29513948 TGCCAGCAATCTTGGCTTGCAGG - Intergenic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1006467347 6:34203505-34203527 TCCCACTGGCCTTGGCGTGCGGG - Intergenic
1007844345 6:44741221-44741243 TGGCTGAGGTCTTGGCCTGCAGG - Intergenic
1008271249 6:49493161-49493183 TGCCAGTGGTCTCTGCCTGAAGG - Intergenic
1010554131 6:77258216-77258238 TGCCACTGGACTGGGCCTGCAGG - Intergenic
1012976625 6:105786967-105786989 TGCCAGAGGTGTTGGCGTCATGG - Intergenic
1016190603 6:141260776-141260798 TCCCTGTGGTCTTGGGGGGCCGG + Intergenic
1016237650 6:141887579-141887601 TGGCAGTGGTGTTGGCATGGGGG - Intergenic
1016952577 6:149594483-149594505 AGCCTGTGGTCTTGGTGTGCTGG - Intergenic
1017928287 6:158929601-158929623 TGCCAGTGGACTTGGTGTGTGGG + Intergenic
1019799601 7:3078475-3078497 TGCCGGTGGTCTGGACGTGCTGG - Intergenic
1020280348 7:6647102-6647124 TGCCAGTGGCATTGGCCTGGCGG + Intronic
1023663158 7:42491347-42491369 TGCCAGTGACCTTGGTGTGCAGG + Intergenic
1024537905 7:50453465-50453487 TGCCAGTTCTCTTGGTGTGAGGG + Intronic
1028972501 7:96875072-96875094 AGCCAGTGGACTTGGATTGCAGG + Intergenic
1032001418 7:128267856-128267878 TGCCAGGGGTCGGGGGGTGCTGG + Intergenic
1035317254 7:158003786-158003808 TACCACTGGCCTTGGCGTGTTGG - Intronic
1038055070 8:23850464-23850486 TGCCAATGGGGTTGGCGTGGAGG - Intronic
1039967191 8:42291991-42292013 TTCCATGGGGCTTGGCGTGCTGG + Intronic
1042505503 8:69555368-69555390 GGCCAGTGGGCTGGGCGTGGTGG + Intronic
1042593798 8:70424163-70424185 GGCCAGTGGTCTTAATGTGCTGG + Intergenic
1045546593 8:103134556-103134578 TGCCAGGAGCCTTGGAGTGCAGG - Intronic
1048153710 8:131920350-131920372 TGCTTGTGGTCTTGGTATGCAGG + Intronic
1048955807 8:139535001-139535023 AGCCAGGTGTCTTGGAGTGCAGG + Intergenic
1049509543 8:143020581-143020603 TGCCAGTGGTCCTGGGGTGGGGG - Intronic
1053345405 9:37374531-37374553 TGCCATTGGTCTGGGGGTGCAGG - Intergenic
1057134815 9:92680376-92680398 TGCCGGAGGCCTTGGGGTGCAGG - Intergenic
1060810599 9:126609818-126609840 TGTCTGTGGTCTTGCTGTGCCGG - Intergenic
1203627078 Un_KI270750v1:34389-34411 TGCCAGTGGCATTGGCGAGCTGG + Intergenic
1186656128 X:11614007-11614029 TGCCAGTGGTCTGGGAGCCCTGG - Intronic
1188531495 X:31145946-31145968 TGCCAGGGGGCTGGGCGTGGAGG - Intronic
1189336462 X:40173493-40173515 AGCCAGTGGTCTTGGCAGGGTGG + Intronic
1197035739 X:121871003-121871025 GGCCAGTGGTGTTGGGGTGGGGG - Intergenic
1198327315 X:135586594-135586616 AGCCAGGGGTCCTGGGGTGCCGG - Intergenic