ID: 937421034

View in Genome Browser
Species Human (GRCh38)
Location 2:121755609-121755631
Sequence GCTCGCGGCGCGCCGGAGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937421034_937421045 15 Left 937421034 2:121755609-121755631 CCGTCCTCCGGCGCGCCGCGAGC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 937421045 2:121755647-121755669 CGACGGTCGTGGCGTAAGACCGG 0: 1
1: 0
2: 0
3: 0
4: 7
937421034_937421050 25 Left 937421034 2:121755609-121755631 CCGTCCTCCGGCGCGCCGCGAGC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 937421050 2:121755657-121755679 GGCGTAAGACCGGGGGGACGCGG 0: 1
1: 0
2: 0
3: 2
4: 40
937421034_937421049 19 Left 937421034 2:121755609-121755631 CCGTCCTCCGGCGCGCCGCGAGC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 937421049 2:121755651-121755673 GGTCGTGGCGTAAGACCGGGGGG 0: 1
1: 0
2: 0
3: 0
4: 21
937421034_937421040 -2 Left 937421034 2:121755609-121755631 CCGTCCTCCGGCGCGCCGCGAGC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 937421040 2:121755630-121755652 GCCTCGGAGGACCCTAGCGACGG 0: 1
1: 0
2: 1
3: 4
4: 65
937421034_937421046 16 Left 937421034 2:121755609-121755631 CCGTCCTCCGGCGCGCCGCGAGC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 937421046 2:121755648-121755670 GACGGTCGTGGCGTAAGACCGGG 0: 1
1: 0
2: 0
3: 0
4: 13
937421034_937421051 28 Left 937421034 2:121755609-121755631 CCGTCCTCCGGCGCGCCGCGAGC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 937421051 2:121755660-121755682 GTAAGACCGGGGGGACGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 75
937421034_937421047 17 Left 937421034 2:121755609-121755631 CCGTCCTCCGGCGCGCCGCGAGC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 937421047 2:121755649-121755671 ACGGTCGTGGCGTAAGACCGGGG 0: 1
1: 0
2: 0
3: 0
4: 5
937421034_937421048 18 Left 937421034 2:121755609-121755631 CCGTCCTCCGGCGCGCCGCGAGC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 937421048 2:121755650-121755672 CGGTCGTGGCGTAAGACCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 7
937421034_937421042 4 Left 937421034 2:121755609-121755631 CCGTCCTCCGGCGCGCCGCGAGC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 937421042 2:121755636-121755658 GAGGACCCTAGCGACGGTCGTGG 0: 1
1: 0
2: 0
3: 2
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937421034 Original CRISPR GCTCGCGGCGCGCCGGAGGA CGG (reversed) Exonic
901381817 1:8879157-8879179 GATCGCGGCGCGAGGCAGGAGGG - Intronic
904593326 1:31627447-31627469 GCTCGTGGCCCGCTGGAGAAAGG - Intronic
912429406 1:109621079-109621101 GCTGGGGGCGGGGCGGAGGAAGG + Exonic
913453172 1:119006710-119006732 GCTGTCGGCGCGCCGGAGCCAGG + Intergenic
916233426 1:162561985-162562007 TCTCGCGGGGTGGCGGAGGATGG - Intronic
919463190 1:197902701-197902723 GCTGGCGGCGGGGCGGCGGAAGG - Exonic
922612447 1:226940409-226940431 GCACGCGGCGGGCCGGCGGGTGG - Intronic
922851166 1:228735336-228735358 GCGCGCGGCGCGCAGGCGGGGGG + Exonic
923490259 1:234478337-234478359 GCCCGCGGCGCGCGCGAGGCGGG - Exonic
924415075 1:243850077-243850099 GCTCGGGCGGCGGCGGAGGATGG + Intronic
1069998036 10:72354954-72354976 GCCCGCGACGCGCCGGCGGGTGG - Exonic
1071695291 10:87863513-87863535 GCTCCCGGCGCGGCGGCGGAGGG + Exonic
1073429803 10:103478762-103478784 GCCCGCAGGGCACCGGAGGAAGG - Exonic
1075748535 10:124744411-124744433 ACTCGCGGCGCGCCGCCGGCGGG + Intronic
1077076949 11:706267-706289 GAGCGCGGGGCGCCGGAGGCAGG + Exonic
1077386133 11:2270360-2270382 GGTCCCGGCGCGCCGCAGGAAGG + Exonic
1077603569 11:3591534-3591556 GCTCACGGAGCGTCGGCGGAAGG - Intergenic
1080406872 11:31987505-31987527 GCGCGCGGGGCGCGGGCGGAGGG - Intronic
1083967581 11:66052087-66052109 GCCGGCGGCGGGCCGGAGGGCGG - Intronic
1084259469 11:67966130-67966152 GCTCACGGAGCGTCGGCGGAAGG - Intergenic
1084813300 11:71629120-71629142 GCTCACGGAGCGTCGGCGGAAGG + Intergenic
1089695088 11:120211723-120211745 GCTCTGGGAGCGCTGGAGGAGGG - Intronic
1090029747 11:123196197-123196219 GCTCGCGGAGGGCAGGAGGCTGG + Intergenic
1092002718 12:5044996-5045018 GCTGGTGGGGCGCCGGAGGGTGG - Exonic
1092430779 12:8407094-8407116 GCTCACGGAGCGTCGGCGGAAGG - Intergenic
1102101311 12:110281107-110281129 GCGCCAGGCGCGCGGGAGGAGGG + Intronic
1113764889 13:112875031-112875053 GCTGGTGGCGGGCAGGAGGATGG - Intronic
1113841260 13:113363085-113363107 GCCTGGGGCGCCCCGGAGGAGGG + Intronic
1114422709 14:22598174-22598196 GCTCGCGGCGGGCCGGCGGTCGG - Intergenic
1119003925 14:70907617-70907639 GCGAGCGGCGGGGCGGAGGACGG - Exonic
1121473577 14:94174674-94174696 GGTCCCGGCGGCCCGGAGGAGGG - Intronic
1124712828 15:32029994-32030016 GCTCGCGGAAAGCGGGAGGAGGG + Intergenic
1125674188 15:41493872-41493894 GCCCGCGGCGCGCCGGGGACTGG - Exonic
1128482811 15:68054509-68054531 GCCCGCGGCCCGCCGCAGGCGGG - Intronic
1131839084 15:96416914-96416936 GCTCTCGTCGCCCCCGAGGAGGG + Intergenic
1142699218 17:1649336-1649358 GCGCGCGGCCCGCGGGAGGGAGG + Intronic
1144169715 17:12648164-12648186 GATCGAGGCCCGTCGGAGGACGG - Intergenic
1148615522 17:48997508-48997530 GCCCGCGGCGCGCAGGGAGACGG - Exonic
1148852231 17:50560900-50560922 GCCCGCGGCGGGGCGGGGGAAGG + Intergenic
1151155699 17:72122008-72122030 GCTCGCGGGGACGCGGAGGAGGG + Intronic
1152357134 17:79812827-79812849 GCTCTCGGCGGGGCCGAGGAGGG + Intergenic
1156275913 18:35582218-35582240 CCTCGCGGCGCCACGGGGGAGGG + Intronic
1160838396 19:1135562-1135584 GGGCGCGGGGCGCCGGAGGTGGG - Intronic
1161231959 19:3178901-3178923 GGGCGCGGGGGGCCGGAGGATGG + Exonic
1163532573 19:17859267-17859289 GCGCGCGGAGAGCCGGAGAATGG - Intergenic
1165349639 19:35268976-35268998 GCTCACGCCGCGCGGCAGGAGGG - Intronic
1166853412 19:45770926-45770948 GCGCGGGGCGCGACGGCGGAGGG + Intronic
927868199 2:26606491-26606513 GCTTGAGGGGCGCGGGAGGAGGG - Intronic
929966751 2:46542617-46542639 TCCCGCGGCGCCCCGGAGGAGGG - Intronic
931762560 2:65431127-65431149 GCTCGGGGCGCTCCGCCGGAGGG - Intronic
935622942 2:105144419-105144441 GCTCGCGGGGCGCCGCAGCTTGG + Intergenic
935692608 2:105744842-105744864 GGGCGCTGCGCGCCGGGGGAGGG + Intergenic
937283303 2:120735360-120735382 GCTCGCTGCCCGCGGGAAGAGGG + Intergenic
937421034 2:121755609-121755631 GCTCGCGGCGCGCCGGAGGACGG - Exonic
938077259 2:128346383-128346405 GCTCGCGGCGCTCGGAAGGCGGG + Intergenic
949032452 2:241803445-241803467 GCTCGGGGCGCCCCGGAAGGCGG - Exonic
1171444842 20:25195940-25195962 GCGCGCTGCGCTCCGGAGGACGG + Intronic
1179150691 21:38806037-38806059 GCTCGGTGCGCGCCGGGCGAGGG - Exonic
1179926820 21:44539320-44539342 GCACGCGGGGCGGCAGAGGAGGG + Exonic
1179932534 21:44579781-44579803 GCACGCGGGGCGGCAGAGGAGGG + Exonic
1179937091 21:44612840-44612862 GCACGCGGGGCGGCAGAGGAAGG - Exonic
1179942155 21:44647282-44647304 GCTTGCGGGGCGGCAGAGGAGGG - Exonic
1181631892 22:24155973-24155995 GCTCGCGGCGGGCCGGGGCGGGG - Intronic
1182516194 22:30860497-30860519 GCTCACTTCGCGCCAGAGGAGGG + Intronic
1183683649 22:39349848-39349870 GCTCGCGGGGCGCGGGCGGGGGG - Intergenic
1184276476 22:43411940-43411962 CCTCGCGGCGCGCGGGCGGGCGG + Intronic
1184523506 22:45008846-45008868 GCTCGGGGCGCGCCGCCGGGTGG - Intronic
949915801 3:8963480-8963502 GCCCGCGACGCGCCAGAGGCGGG + Exonic
951078691 3:18425775-18425797 GCGCGCGGCGCGCGGGCGGCAGG + Intronic
951981796 3:28575281-28575303 TCTCGCGGCGCGCCGGAGTTTGG - Intergenic
953912171 3:46898709-46898731 GCTCACGGCGCGCAGCATGAAGG - Exonic
954378030 3:50205177-50205199 CCTGGCGGCCCGCGGGAGGAGGG - Intergenic
961279676 3:125756161-125756183 GCTCACGGAGCGTCGGCGGAAGG + Intergenic
966849365 3:184155332-184155354 GGCCGCGCCGGGCCGGAGGAGGG + Intronic
966982727 3:185153030-185153052 GCGCGCGCCGCGCCGGAGGGAGG - Intergenic
968093029 3:195909735-195909757 GCTCGGGGCGCTCGGCAGGAGGG - Intronic
969018037 4:4118187-4118209 GCTCACGGAGCGTCGGCGGAAGG - Intergenic
969735956 4:8990526-8990548 GCTCACGGAGCGTCGGTGGAAGG + Intergenic
976184169 4:82429199-82429221 GCGTGCGGCGCGCTGGGGGAGGG + Intronic
985495400 5:201850-201872 GCTCGCTGCAGGGCGGAGGAGGG - Exonic
985784634 5:1887340-1887362 GCGCGCGGCGCGCCGGGTGCAGG + Intergenic
990919392 5:60945622-60945644 GCCCGGGGCACGCCGGGGGAAGG - Intronic
992042446 5:72848742-72848764 GCTTCCGGCGCGCAGGAGGCGGG + Intronic
995650492 5:114362730-114362752 TCTCGCGGCGCGCCTGGGGCTGG - Exonic
996862728 5:128083976-128083998 AGTCCCGGGGCGCCGGAGGAGGG - Exonic
1001035096 5:168291806-168291828 GCGCGCCGCGCGGCGGAGGAGGG + Intronic
1001959588 5:175872143-175872165 GCACGCTTCGCCCCGGAGGAGGG + Intronic
1008027400 6:46653337-46653359 GCACGCGCCGCGCTGGGGGAGGG + Intronic
1016330259 6:142946523-142946545 GCGCGCGGGGCGACGGGGGAGGG + Intergenic
1022018586 7:26376746-26376768 GCTCGCGCCCGGCCGGAGGAGGG + Intergenic
1022698120 7:32729101-32729123 GCCCCCGGCGCCCCGGCGGAAGG - Intergenic
1026470939 7:70693978-70694000 GCGCGGGGCGGGACGGAGGAGGG + Intronic
1027138097 7:75638896-75638918 ACTCCAGGCGTGCCGGAGGAGGG - Intronic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1031966597 7:128031796-128031818 GCCGGCGGCGCGCCGGGGGCCGG - Intronic
1033253400 7:139778505-139778527 GCGCGCCGTGCTCCGGAGGAGGG + Intronic
1035169590 7:157010120-157010142 GCTCTCGGCGCGCAGGCGGTCGG + Exonic
1036241269 8:7083046-7083068 GCTCACGGAGCGTCGGTGGAAGG + Intergenic
1036930562 8:12951804-12951826 CCGCGCGGGGCGCCGGAGTAGGG + Intronic
1039875090 8:41578316-41578338 GCTCTCGGCTCCCCGGAGGTCGG - Intronic
1041167238 8:55102277-55102299 GCTAGCGGCGCGCCTGGGGCCGG - Intergenic
1042902788 8:73746224-73746246 GGCCGGGGCGCGCCGGAGGGTGG - Intronic
1045547391 8:103140879-103140901 GCTCCCGCGGCGCAGGAGGATGG + Exonic
1049651489 8:143771806-143771828 GCTCCCGGCGCACCGGAGCCAGG - Intergenic
1060832177 9:126723432-126723454 GCTCGCTGCGCTCCGGGTGATGG + Intergenic
1062529079 9:136992124-136992146 GCGCGGGGCGGGCCGGAGCAGGG - Intergenic
1187055401 X:15737931-15737953 GCCAGCGGCGAGCAGGAGGAGGG + Intronic
1189054542 X:37685625-37685647 GTTCGCGGCCCGCCAGGGGACGG + Intronic
1197746168 X:129933003-129933025 ACTCGCGGCTGGCGGGAGGAGGG + Intergenic
1200092963 X:153644328-153644350 GCTCGCTGCCCGCCGCAGGGTGG - Intronic
1200147680 X:153935009-153935031 GCTCGCTGGGCGACGGCGGAAGG + Exonic