ID: 937421134

View in Genome Browser
Species Human (GRCh38)
Location 2:121756126-121756148
Sequence ACGCTCATTCGCTGAAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937421134_937421135 -5 Left 937421134 2:121756126-121756148 CCTGGTCTTCAGCGAATGAGCGT No data
Right 937421135 2:121756144-121756166 AGCGTTTCGTGTATTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937421134 Original CRISPR ACGCTCATTCGCTGAAGACC AGG (reversed) Intronic
No off target data available for this crispr