ID: 937422039

View in Genome Browser
Species Human (GRCh38)
Location 2:121765383-121765405
Sequence CCGCTGAGGTCAGCAAGGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937422039_937422048 14 Left 937422039 2:121765383-121765405 CCTGGCCTTGCTGACCTCAGCGG 0: 1
1: 0
2: 3
3: 30
4: 256
Right 937422048 2:121765420-121765442 TGAGCACAGAGTGCCTCTTACGG 0: 1
1: 0
2: 0
3: 25
4: 208
937422039_937422046 -9 Left 937422039 2:121765383-121765405 CCTGGCCTTGCTGACCTCAGCGG 0: 1
1: 0
2: 3
3: 30
4: 256
Right 937422046 2:121765397-121765419 CCTCAGCGGTTGCCAGGAAGGGG 0: 1
1: 0
2: 0
3: 14
4: 187
937422039_937422049 22 Left 937422039 2:121765383-121765405 CCTGGCCTTGCTGACCTCAGCGG 0: 1
1: 0
2: 3
3: 30
4: 256
Right 937422049 2:121765428-121765450 GAGTGCCTCTTACGGTAGTTAGG 0: 1
1: 0
2: 0
3: 1
4: 33
937422039_937422044 -10 Left 937422039 2:121765383-121765405 CCTGGCCTTGCTGACCTCAGCGG 0: 1
1: 0
2: 3
3: 30
4: 256
Right 937422044 2:121765396-121765418 ACCTCAGCGGTTGCCAGGAAGGG 0: 1
1: 0
2: 2
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937422039 Original CRISPR CCGCTGAGGTCAGCAAGGCC AGG (reversed) Exonic
900158684 1:1213394-1213416 CTGCTCAGGCCAGCAAGGCCAGG + Intronic
900161639 1:1226891-1226913 CCCCTGAGCTCACGAAGGCCTGG - Intronic
900289671 1:1918652-1918674 TCGCTGAGGACAGCGAGTCCTGG - Intronic
900376804 1:2358683-2358705 CCGCTGAGATCTGCAGGACCCGG + Exonic
901063418 1:6484338-6484360 CAGATGAGGTCAGCCGGGCCTGG - Intronic
901170911 1:7256611-7256633 CTGCTGAGTTCACAAAGGCCTGG + Intronic
901814107 1:11784360-11784382 AAGCTGCGGGCAGCAAGGCCAGG + Exonic
902612308 1:17604344-17604366 CCCTTGAGGTCAGCAGGGCCAGG + Intronic
903128232 1:21262095-21262117 ACCCTGAGGTCAGCAAGACCGGG - Intronic
903128902 1:21265718-21265740 ACTCTGAGTTCAGCAAGACCAGG + Intronic
903217472 1:21851441-21851463 CCCCTGAGATCAGGAAGCCCTGG - Intronic
903493986 1:23752071-23752093 CCTCTGAGCTCTGCAGGGCCAGG - Intronic
903514730 1:23902827-23902849 CCGCCGTGGGCAGGAAGGCCGGG - Intronic
904207811 1:28866009-28866031 GTCCTGAGGTCAGCAGGGCCCGG + Intergenic
904497231 1:30893764-30893786 CAGCTGGGGTCAGAGAGGCCAGG - Intronic
904899575 1:33846402-33846424 CTGCAGAGGTCAGCAAAGGCTGG + Intronic
905274345 1:36807376-36807398 CCCCTGAGATCAGCCAGGACAGG - Intronic
906801504 1:48741464-48741486 CTGCTGAAGGCAGCAAGGCAAGG + Intronic
907316824 1:53577580-53577602 CACCTGAGGGCAGCCAGGCCTGG + Intronic
908775941 1:67639990-67640012 ACACTGAGGTCAGGAAGACCTGG - Intergenic
911057506 1:93721165-93721187 CCTCTGAAGTCAGCATGGCAGGG + Intronic
915511859 1:156390943-156390965 GAGCTGAGGCCAGCAGGGCCAGG - Intergenic
916488367 1:165279291-165279313 CCTCTGCGGTCAGCAAGCACAGG + Intronic
919397496 1:197069153-197069175 CTCCTGAAGTCAGCAAGACCAGG - Intergenic
919923033 1:202177562-202177584 CCGCTGTGGTCAACCTGGCCTGG + Intergenic
919977510 1:202622544-202622566 TCGCTGAGATCAGCAATTCCAGG + Intronic
920312806 1:205058446-205058468 CATGTGAGGTCAGGAAGGCCCGG - Intronic
921937812 1:220810831-220810853 ACTCTGAAGTCAGCCAGGCCTGG + Intronic
923052325 1:230397271-230397293 CCACTGAGGTTAGCAAAGCCAGG - Intronic
924434846 1:244030313-244030335 CTGCAGAGGTAAGCCAGGCCAGG + Intergenic
1063072363 10:2679765-2679787 CAGCAGAGGTCAGCAGGGTCAGG - Intergenic
1063086293 10:2821114-2821136 CTGCTGAGGTAAGAAAGCCCTGG + Intergenic
1063101041 10:2950496-2950518 CTGCTCAGGTCTGCAAGGACAGG - Intergenic
1063762677 10:9098141-9098163 CAGCAGAGGGCAGCTAGGCCAGG + Intergenic
1066542027 10:36457724-36457746 CTGCTGAGACCAGCTAGGCCGGG - Intergenic
1067436965 10:46285002-46285024 CCGCCGGGGTAAGGAAGGCCGGG - Intergenic
1069930953 10:71881208-71881230 CTGCTGAGCTCTGCATGGCCCGG - Intergenic
1069952153 10:72026473-72026495 CCCCAGAGCTCAGCCAGGCCAGG - Intergenic
1070752583 10:78972925-78972947 ACGCTGAGGCCAGCCAGGCCGGG + Intergenic
1072189173 10:93066484-93066506 CCGCTGAGGGACGCAAAGCCTGG + Intronic
1072813928 10:98486324-98486346 CCTCTGAGGTTATCAAGTCCAGG + Intronic
1073035471 10:100561951-100561973 CCCCTGACCTCAGGAAGGCCAGG - Intergenic
1075630908 10:124000155-124000177 GCGGTGAGGTCAGCATAGCCAGG + Intergenic
1076125605 10:127971531-127971553 CCTGCGAGGACAGCAAGGCCAGG - Intronic
1076138872 10:128064139-128064161 CAGCTGAGCTCCCCAAGGCCTGG - Intronic
1077041965 11:528811-528833 CCGCGCAGGTCAGCTGGGCCTGG - Intergenic
1077515661 11:3000534-3000556 CCGCTGGAGACAGCAAGTCCAGG - Intergenic
1077580471 11:3414050-3414072 CTGCTGAGGTCAGCATGACCTGG - Intergenic
1077583645 11:3434288-3434310 CTGCTGAAGCCAGCAAGACCAGG - Intergenic
1077787976 11:5404860-5404882 CTCCTGAAGTCAGCAAGACCAGG + Intronic
1079322593 11:19463879-19463901 CCCCTGACTTCAGCATGGCCAGG - Intronic
1084196056 11:67524058-67524080 TCTCTGAGGTCGGCAGGGCCGGG - Intergenic
1084237402 11:67796879-67796901 CTGCTGAGGTCAGCATGACCTGG - Intergenic
1084602223 11:70152651-70152673 GCGCTGAGCTCCCCAAGGCCTGG + Intronic
1084835000 11:71795949-71795971 CTGCTGAGGTCAGCATGACCTGG + Intronic
1087020637 11:93599388-93599410 CCAGTGAGGTCAGAAGGGCCAGG + Intergenic
1087046123 11:93845340-93845362 CCTCTGGGGTCAGCATGGCACGG + Intronic
1090363428 11:126188373-126188395 CGGCAGAGGTCAGAAAGCCCAGG - Intergenic
1090924663 11:131238985-131239007 CCTCTGAAGTCAGCCAGGCTGGG - Intergenic
1091293303 11:134454497-134454519 GAGCTGAGGTCAGCATGGCAGGG + Intergenic
1092097527 12:5855728-5855750 CAGCTGAGGAAAGCAAGGCAGGG + Intronic
1092124532 12:6066001-6066023 CTGCCGAGGTCAGCACTGCCTGG - Intronic
1092243902 12:6852349-6852371 CCGCTGGGGCCTGCAAGGCTTGG + Intronic
1092408060 12:8234471-8234493 CTGCTGAGGTCAGCATGAACTGG - Intergenic
1093911978 12:24758770-24758792 CAGCTGAGGTGAGAGAGGCCAGG + Intergenic
1095347831 12:41172493-41172515 CACCTGAGGTCAGGAAGGTCAGG - Intergenic
1096103080 12:48981023-48981045 CCCCTGGGCTCAGCTAGGCCTGG + Intronic
1096426216 12:51505643-51505665 CCACTGAGGTCAGAATGGCAAGG - Intronic
1096692460 12:53329372-53329394 ACGCTGCCGTCAGCATGGCCAGG + Exonic
1101156970 12:101936835-101936857 TAACTGAGGTCAGCAAGGCCTGG - Intronic
1101660552 12:106761419-106761441 CCGTTGATGTAAGCAAAGCCAGG - Exonic
1103978034 12:124716530-124716552 CAGGTGAGGTCAGCAGAGCCCGG - Intergenic
1104178078 12:126351900-126351922 CAGCTGAGGTCACACAGGCCTGG - Intergenic
1104757044 12:131275947-131275969 CAGCTGGGGTCCTCAAGGCCAGG - Intergenic
1104897570 12:132171815-132171837 GTGCTGAGCTCAGCAAGGGCAGG + Intergenic
1107671374 13:42749813-42749835 CAGCAGAGATAAGCAAGGCCGGG + Intergenic
1112506524 13:99979613-99979635 CCGCAGCGGTCAGCCAGGCGCGG + Intergenic
1112572707 13:100608303-100608325 CCACTGCTGTCAGCAAGGGCTGG + Intronic
1113300194 13:109011147-109011169 TATCTGAGGTCAGCAATGCCTGG - Intronic
1114295391 14:21324754-21324776 CGGCAGATGTCAGGAAGGCCTGG - Exonic
1118767270 14:68918225-68918247 CCCCTGAGGCCAGCATGGCAGGG + Intronic
1119086412 14:71743493-71743515 CTGCTGAGGAAAGCAGGGCCTGG + Intergenic
1119322419 14:73739780-73739802 CCACAGAGTTCAGCAGGGCCAGG + Exonic
1119738073 14:76996633-76996655 CTGCTGGGGTCAAAAAGGCCAGG - Intergenic
1121322704 14:93001812-93001834 CAGCTGAGGGCCACAAGGCCTGG + Intronic
1121432546 14:93898184-93898206 CTGCTGGGGTCAGAGAGGCCAGG + Intergenic
1121669264 14:95695418-95695440 CTGCTGAGGTCAGCTTGCCCTGG + Intergenic
1122050455 14:99055910-99055932 CAGCTGAGATCAGCTAAGCCTGG - Intergenic
1122537348 14:102474916-102474938 CAGATGAGGAAAGCAAGGCCTGG + Intronic
1122773939 14:104108975-104108997 CAGCTGAGGTCTGCAAGGGGTGG - Intronic
1122993290 14:105248938-105248960 CCGCCGTGGGCAGGAAGGCCGGG + Exonic
1123040367 14:105487837-105487859 CGGCTTAGGTCAGCAGGGCCTGG - Intronic
1123111119 14:105867237-105867259 CTGCTCAGGGCAGCCAGGCCAGG - Intergenic
1123113703 14:105884400-105884422 CCGCTGTGTTCCGCAGGGCCAGG - Intergenic
1123115929 14:105894039-105894061 CCGCTGTGTTCCGCAGGGCCAGG - Intergenic
1123117956 14:105903149-105903171 CCGCTGTGTTCCGCAGGGCCAGG - Intergenic
1125895479 15:43298312-43298334 CCTGTGAGGGCAGCAGGGCCAGG + Intronic
1126382133 15:48059891-48059913 CCTCTGAGGTCAGCCATGCATGG + Intergenic
1128532171 15:68461940-68461962 CCCCTGAGGTCAGCCTGGCAGGG - Intergenic
1129686342 15:77688179-77688201 CCTCTGAAGACAGCAGGGCCAGG + Intronic
1129871347 15:78943913-78943935 CCACTGAGGTTTGCAAGGCTGGG + Intronic
1131177674 15:90220140-90220162 CAGAAGAGGGCAGCAAGGCCTGG - Intronic
1131223566 15:90605633-90605655 CCGCTGAGATCAGAGAGACCTGG - Intronic
1132536659 16:484922-484944 CTGCTGAGGTCAGGGAGCCCAGG - Intronic
1132546628 16:536185-536207 CCACTGAGGACAGCAGGGACAGG - Intronic
1132731729 16:1366231-1366253 CCGCTGAGGTCACCACTGCAGGG + Intronic
1132814124 16:1817846-1817868 CACGTGAGGTCAGCGAGGCCAGG - Intronic
1132873648 16:2126366-2126388 CTGCTAAGGTCAGGAATGCCAGG + Intronic
1132883157 16:2171159-2171181 CCTCAGAGGACAGCCAGGCCTGG + Intronic
1133349018 16:5089302-5089324 CTGCTGACGTCAGCATGACCTGG - Intronic
1134552736 16:15145540-15145562 CTGCTAAGGTCAGGAACGCCAGG + Intergenic
1134689772 16:16183596-16183618 GCAAGGAGGTCAGCAAGGCCAGG - Intronic
1135338876 16:21629585-21629607 CTCCTGAGGCCAGCAAGACCAGG - Intronic
1137522363 16:49205336-49205358 CACCTGAGCTCAGCCAGGCCTGG - Intergenic
1139505922 16:67398085-67398107 CCGCTGGGGGCAGCAGGGACCGG - Intronic
1139521155 16:67483383-67483405 CCGCTGCGGTCAGCATGGCCTGG + Exonic
1140087197 16:71808126-71808148 ACGCTGACGTCCGCAGGGCCAGG + Intronic
1140504193 16:75460102-75460124 CCACTGAGGTGAGGCAGGCCAGG - Intronic
1140511587 16:75512608-75512630 CCACTGAGGTAAGGCAGGCCAGG - Intergenic
1141175678 16:81717401-81717423 CACCTGAGGTCAGGAAGGTCAGG - Intergenic
1141337022 16:83165610-83165632 CTGCTGAGGTCATCAATTCCAGG - Intronic
1141574596 16:84955777-84955799 GCCCTGAGGTCAGCCAAGCCAGG - Intergenic
1141990343 16:87605712-87605734 CAGATGAGGCCAGTAAGGCCCGG + Intronic
1142143599 16:88483343-88483365 CCTCTGAGGTCAGCACGGCCAGG + Intronic
1142172213 16:88628718-88628740 CCAGTGAGGACAGCAGGGCCAGG - Intronic
1142482853 17:229425-229447 CAGCTGGGGTCAGCAAGGGGTGG + Intronic
1142743138 17:1942110-1942132 GGGCTGAGGAGAGCAAGGCCGGG + Intronic
1143249535 17:5512656-5512678 GCCCTGAGCTCAGCAGGGCCTGG + Intronic
1144001358 17:11058067-11058089 CCACTGAGCTCAACAAGGCTAGG - Intergenic
1144093740 17:11881370-11881392 CCGCTGTGGTCAGCATGGAGAGG + Exonic
1145757534 17:27403614-27403636 GCTCTGAGGTCAGCCCGGCCTGG - Intergenic
1145903989 17:28506470-28506492 CCGTGGAGGCCAGCAGGGCCGGG + Intronic
1148225893 17:45897413-45897435 CCGCTGCGGTGGGCAAGGCCGGG + Intronic
1148819243 17:50350996-50351018 CAGATGAGGTCAGAGAGGCCTGG + Intronic
1150135332 17:62692286-62692308 GGGCTGCGGTCAGCAAGGCCAGG - Exonic
1151321612 17:73356060-73356082 CAGATGAGGACACCAAGGCCTGG + Intronic
1152051762 17:77984606-77984628 CCACTGAGGTGAGCACTGCCAGG - Intergenic
1152462580 17:80449329-80449351 CCTCAGAGGTGAGCAATGCCAGG + Intergenic
1152534208 17:80941080-80941102 CAGCTGAGGAAAGCAGGGCCTGG - Intronic
1152704293 17:81834749-81834771 CCCCTCAGGTGAGCAAAGCCTGG - Exonic
1152750159 17:82058921-82058943 CAGCTGTGGCCAGCCAGGCCAGG + Intronic
1152860279 17:82692369-82692391 CCGATACGGTCAGCGAGGCCTGG - Intronic
1154172987 18:12064032-12064054 CCCCTGAGGCCAGGAAGCCCTGG + Intergenic
1154322906 18:13368905-13368927 CCGCTGAGTCCATGAAGGCCAGG - Intronic
1154329035 18:13414696-13414718 CTGCTGAGGACAGCAAGGGCAGG - Intronic
1155392154 18:25349755-25349777 CCGCCGAGGTCCGCGCGGCCCGG - Intronic
1159040837 18:63321081-63321103 GCGCTGAGTTCTGCATGGCCTGG - Intergenic
1159957575 18:74530534-74530556 TCACTGAGGTGGGCAAGGCCTGG + Intergenic
1160362354 18:78294637-78294659 CCGCTGAGGTTGGCCAGACCAGG - Intergenic
1160658522 19:287473-287495 CTGCTGATGTCACCGAGGCCAGG - Exonic
1160710646 19:549544-549566 CCGCCGAGGGGAGCAGGGCCAGG - Intronic
1161615655 19:5268815-5268837 CTTCTGAGCTCAGCCAGGCCTGG - Intronic
1164587252 19:29483781-29483803 CAGCTGAGGTCAGATAGACCTGG - Intergenic
1164592846 19:29515641-29515663 GCTCTGAGCCCAGCAAGGCCTGG + Intergenic
1164832202 19:31331208-31331230 CAGGTGAGCTCAGGAAGGCCTGG - Intronic
927107983 2:19844208-19844230 CTGATGAGGACAGGAAGGCCTGG + Intergenic
927857802 2:26538149-26538171 CTGCTCAGGGCAGCAGGGCCCGG - Intronic
927880116 2:26684272-26684294 CATCTGAGATCACCAAGGCCAGG + Intergenic
929631541 2:43467944-43467966 CCGCTGAGCTAAGCCAGACCAGG + Intronic
932144476 2:69306158-69306180 TGGCTGAGGTCAGCGAGGCTGGG - Intergenic
934555486 2:95285022-95285044 CGGCTGAGCTCAGCAGGTCCAGG - Exonic
934923834 2:98367482-98367504 CAGCTGAGGTCAGCCGGGCGGGG - Intronic
935179156 2:100674935-100674957 CCACTGAGCTCAGCCAGGGCTGG - Intergenic
937422039 2:121765383-121765405 CCGCTGAGGTCAGCAAGGCCAGG - Exonic
938992917 2:136647708-136647730 CAGCTGAGGTCAGGAAGGTGTGG + Intergenic
943915559 2:193627760-193627782 CTGCTGAGGTCAGCGATTCCTGG - Intergenic
944672763 2:202009099-202009121 CAGCTGCTGTCAGCAAAGCCTGG - Intergenic
946144096 2:217715677-217715699 CAGCTGAGATCAGCCAAGCCTGG + Intronic
946460490 2:219864296-219864318 CCCCTGAGGTCATAAAAGCCAGG - Intergenic
946704512 2:222445164-222445186 CCACCAAGTTCAGCAAGGCCAGG - Intronic
1168855969 20:1009278-1009300 CCTCTGAAGTCAGCATGGCAGGG - Intergenic
1169353073 20:4885738-4885760 CTGCTGAGGGCAGCACGTCCAGG + Intronic
1170347644 20:15404730-15404752 CCCAGGAGGACAGCAAGGCCTGG - Intronic
1171265339 20:23767107-23767129 CCCCTGGGGTGAGGAAGGCCAGG + Intergenic
1171330848 20:24337714-24337736 CCACTGAGGACAGCTTGGCCCGG + Intergenic
1171480763 20:25454273-25454295 GCTGTGATGTCAGCAAGGCCAGG + Intronic
1171986373 20:31664366-31664388 CCCCTGAGGGCAGCAGAGCCAGG + Intergenic
1172512528 20:35510347-35510369 CCTCTGAGGGCAGGGAGGCCAGG - Intronic
1173619930 20:44429204-44429226 CCGCTGGGGACAGCCAGGCCTGG + Intronic
1174417480 20:50377044-50377066 CACCTGATGTCAGCAAGGCCTGG + Intergenic
1175875575 20:62227797-62227819 CAGCTGAGGTCAGCATAGGCAGG + Intergenic
1176089241 20:63311707-63311729 GCCCTGAGGGCAGCGAGGCCCGG + Exonic
1176199462 20:63853988-63854010 CCACTCAGGTCAGCACTGCCTGG + Intergenic
1178685631 21:34708436-34708458 CACCTGAGACCAGCAAGGCCAGG + Intronic
1179012780 21:37569083-37569105 CAGCTCAGATCAGCAAGGGCAGG - Intergenic
1179726442 21:43343881-43343903 CCCCTGAGTTCACCCAGGCCTGG - Intergenic
1180142902 21:45903107-45903129 CATCTGAGGCCAGCAGGGCCTGG + Intronic
1181672825 22:24433729-24433751 CCGCTCCGGTGAGCAGGGCCGGG + Exonic
1182511028 22:30820546-30820568 CCTCTGAGGTCAGCCAGACCAGG + Intronic
1182846110 22:33432251-33432273 CCTCACAGGTCAGCAAGTCCTGG - Exonic
1183219647 22:36504421-36504443 CAGCTGGGGTCAGGAAGGGCAGG + Intronic
1183307751 22:37091908-37091930 CCACTGCAGTCAGCATGGCCAGG - Intronic
1183353170 22:37344706-37344728 CCGCAGAGGTCAGCCATGCTGGG - Intergenic
1183391309 22:37546938-37546960 CCGCAGCGGGCTGCAAGGCCGGG - Intergenic
1183439159 22:37813459-37813481 CCTCTGGGGTCAGCAGGGCCTGG - Exonic
1183795155 22:40111309-40111331 CCACTGCGGTCGGCGAGGCCTGG - Intronic
1185128940 22:49026644-49026666 TCTCTGAGGGCAGCAAGGACTGG + Intergenic
1185140161 22:49095576-49095598 CCGCTGAGGTCGGCCTGGCTGGG + Intergenic
949748530 3:7324429-7324451 GGGCTGAGGTCAGCAGGTCCAGG - Intronic
953136870 3:40189370-40189392 CCTCTGAGGTCTGCCAGGGCAGG + Intronic
954956924 3:54529481-54529503 CCGCTGATGTCAGCATGCTCAGG - Intronic
956719658 3:72106669-72106691 CAGATGAGGACACCAAGGCCTGG + Intergenic
957086494 3:75684154-75684176 AGGCAGAGGGCAGCAAGGCCAGG + Intergenic
960258230 3:115533698-115533720 CCCCTGAGCTCTGCAAAGCCTGG + Intergenic
961301478 3:125924898-125924920 CTGCTGAGGTCAGCATGACCTGG + Intergenic
961886988 3:130102959-130102981 CTGCTGAGGTCAGCATGAACTGG - Intronic
962763696 3:138542268-138542290 CCGCTGTGGGCACCAATGCCTGG + Intronic
962837585 3:139202836-139202858 TCCCTGAGGTTAGCTAGGCCAGG + Intronic
964525701 3:157613624-157613646 CCGCAGGGGTCAGCAGAGCCTGG + Intronic
964972623 3:162579905-162579927 CTCCTGAAGTCAGCAAGACCAGG + Intergenic
965016779 3:163168321-163168343 CTGCTAAGGTCTGCAAGGCAGGG + Intergenic
965655222 3:170976359-170976381 CAGCCTAGTTCAGCAAGGCCAGG - Intergenic
967850115 3:194076036-194076058 GCACTGAGGTCAGCCTGGCCTGG + Intergenic
968058603 3:195711720-195711742 CCACTGAGGCCAGCATGGCTGGG + Intergenic
968480269 4:830165-830187 CCTCTGAGCTGGGCAAGGCCAGG + Intergenic
968845108 4:3036652-3036674 CCTCTGAGGACAGCAGTGCCGGG + Intronic
968996141 4:3946963-3946985 CTGCTGTGGTCAGCATGACCTGG - Intergenic
969326013 4:6444273-6444295 CCGCGGAGATCAGGGAGGCCTGG + Intronic
969599128 4:8165524-8165546 CCGGTGAGGCCAACAAGGCCAGG - Intergenic
969757843 4:9161735-9161757 CTGCTGAGGTCAGCATGAACTGG + Intergenic
969817824 4:9699277-9699299 CTGCTGAGGACAGCATGACCTGG + Intergenic
971158351 4:24106851-24106873 CAGCTGAGATCAGCAGAGCCTGG + Intergenic
972674757 4:41249640-41249662 CACCTGAGGTCAGCCATGCCTGG + Intergenic
975160853 4:71121894-71121916 CTCCTGAGGCCAGCAAGACCAGG + Intergenic
975674118 4:76809890-76809912 CAGCTGGGATCAGCCAGGCCTGG - Intergenic
977260290 4:94788962-94788984 CCCCTGAGGTGATGAAGGCCTGG + Intronic
978618058 4:110615118-110615140 GCGCTGAGGCCAGTGAGGCCTGG + Intergenic
981034840 4:140158673-140158695 CAGCTGAGGTTAGGAAGGCCCGG - Intergenic
985604967 5:853556-853578 CCACAGAGGACAGCAAGCCCGGG + Intronic
987215647 5:15734165-15734187 CAGCTGGGGACAGCAAGGTCAGG - Intronic
991001449 5:61787590-61787612 CCTCTGAGAGAAGCAAGGCCAGG + Intergenic
997444968 5:133934039-133934061 CTGGTGTGGTCAGCAAAGCCTGG + Intergenic
997472050 5:134122611-134122633 CTGCTGAGGTCAGGCAGGTCAGG + Intronic
999148771 5:149413002-149413024 CCGATGAGCTGAGCAAGGCAGGG + Intergenic
999654219 5:153796880-153796902 CCCCTACTGTCAGCAAGGCCTGG + Intronic
1001639778 5:173236172-173236194 CCTCTGAGCCCAGCTAGGCCAGG + Intergenic
1002368138 5:178729302-178729324 CCGCTGAGCCCACCAGGGCCAGG + Intronic
1002385187 5:178860746-178860768 CCGCTGAGCCCACCAGGGCCAGG - Intronic
1005953239 6:30646630-30646652 GGGCTGCGGTCACCAAGGCCTGG - Exonic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1009691008 6:67031766-67031788 CCCCTGAGGCCAGCAAGACCAGG + Intergenic
1012748644 6:103127655-103127677 CTCCTGAAGTCAGCAAGACCAGG - Intergenic
1015490122 6:133815423-133815445 CCCCTGAGTTCAGCCAGGTCTGG - Intergenic
1018866152 6:167748388-167748410 ACGCTGAGGTCCCCAATGCCAGG + Intergenic
1019151804 6:170011345-170011367 CCAGTGAGGACAGCCAGGCCTGG + Intergenic
1019177546 6:170167903-170167925 ATGCTGGGGTCAGCAAGGGCTGG - Intergenic
1019950014 7:4364538-4364560 CCTTTGAGGTCAGCGTGGCCAGG - Intergenic
1020320420 7:6935373-6935395 CTGCTGAGGTCAGCATGACCTGG - Intergenic
1020440580 7:8212681-8212703 CAGCTGGTGTCAGCAAGGGCGGG + Intronic
1023966784 7:44967001-44967023 GGGCAGAGGCCAGCAAGGCCAGG + Intronic
1023967573 7:44970850-44970872 CAGCTGAGGCCAGCTATGCCCGG - Exonic
1023983575 7:45082826-45082848 GCCCTGAGGTCAGCCAGGCCCGG - Exonic
1028700941 7:93778538-93778560 CCGCTGAGGTCAGCACAGGCAGG - Intronic
1028796276 7:94907719-94907741 CCGCGGGGGTGAGGAAGGCCGGG - Intronic
1028987824 7:97021807-97021829 CCTCGGGGGTGAGCAAGGCCTGG - Intronic
1029365340 7:100112860-100112882 CCCCTGAAGTCAGCCAAGCCAGG - Exonic
1030348976 7:108462119-108462141 CAGATGAGGTCATCAAGGACAGG + Intergenic
1032410115 7:131688598-131688620 CGTCTGAGGACAGCAGGGCCTGG - Intergenic
1034546874 7:151794990-151795012 CCCCTGAGGTCAGGACGGTCAGG - Intronic
1035288053 7:157818903-157818925 CCTCTGAAACCAGCAAGGCCAGG + Intronic
1036381096 8:8237058-8237080 CTGCTGAGGTCAGCGTGACCTGG + Intergenic
1036848471 8:12185571-12185593 CTGCTGAGGTCAGCATGAACTGG - Intronic
1036869831 8:12427852-12427874 CTGCTGAGGTCAGCATGAACTGG - Intronic
1038271746 8:26081228-26081250 CGGCTGAAGTGAGCATGGCCTGG - Intergenic
1039309884 8:36305841-36305863 CTGCTGAGATAGGCAAGGCCAGG + Intergenic
1039665518 8:39522759-39522781 CCGCGGAGGTCAGCCGGCCCAGG + Intergenic
1039948953 8:42153084-42153106 GCGCTGAGAGCAGCAAGGCCAGG + Exonic
1040804492 8:51378688-51378710 CTGCTGAGGCCAGCAAGACCAGG + Intronic
1043180755 8:77083727-77083749 CCGCTGAGGTGAGGAAGGCACGG - Intergenic
1043523543 8:81072375-81072397 CCCCAAATGTCAGCAAGGCCAGG - Intronic
1043527304 8:81111401-81111423 ATGCTGAGGTCAGCCAGCCCTGG + Intronic
1044620512 8:94186863-94186885 CTGCGGAGGTCAGCACGGGCTGG - Intronic
1044849904 8:96418074-96418096 CTACAGATGTCAGCAAGGCCAGG + Intergenic
1049266330 8:141669833-141669855 CCTCTGTGCCCAGCAAGGCCTGG - Intergenic
1049683722 8:143930930-143930952 CCTCTGAGGTCGGCAGGGCTGGG - Intronic
1056236088 9:84596169-84596191 CTGCAGAGGTCAGCAAGGAAGGG - Intergenic
1060862313 9:126964605-126964627 CCTCTGAGGTCAGATAGGCCTGG - Intronic
1061141345 9:128769074-128769096 CCGCTGCTGTCAGAAAAGCCAGG + Intronic
1061513895 9:131077304-131077326 CCGGGGAAGCCAGCAAGGCCAGG - Exonic
1062424081 9:136498075-136498097 CCCCAGAGGGCATCAAGGCCTGG - Intronic
1062522957 9:136966258-136966280 CTGCTGAGGTCATCAAGGACCGG + Intergenic
1062640654 9:137516324-137516346 CCTGTGTGGTCGGCAAGGCCAGG - Intronic
1187989354 X:24852598-24852620 AAGCTGAGGTCAGCCAGGCATGG - Intronic
1192308576 X:69989155-69989177 CCCCTGATGCCAGCAGGGCCTGG + Intronic
1193364016 X:80608803-80608825 TAGCTGATGTCAGCAAGGCCAGG - Intergenic
1199628853 X:149762370-149762392 CCGCTGAGGGCAGCGGGCCCAGG - Intergenic
1199843803 X:151676192-151676214 CCAATGAGGTCTGCATGGCCAGG + Exonic
1199850647 X:151723047-151723069 CCGCTGAGGTCAGGAAGGCAAGG - Exonic
1200010188 X:153114666-153114688 CTGCAGAGGTCAGAAGGGCCTGG - Intergenic
1200029412 X:153285256-153285278 CTGCAGAGGTCAGAAGGGCCTGG + Intergenic