ID: 937425957

View in Genome Browser
Species Human (GRCh38)
Location 2:121798571-121798593
Sequence CATTGCAACCATGAGCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937425957_937425962 2 Left 937425957 2:121798571-121798593 CCCCAGAGCTCATGGTTGCAATG No data
Right 937425962 2:121798596-121798618 CCCGCTTATCGGAGTCTTCCTGG No data
937425957_937425960 -9 Left 937425957 2:121798571-121798593 CCCCAGAGCTCATGGTTGCAATG No data
Right 937425960 2:121798585-121798607 GTTGCAATGTGCCCGCTTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937425957 Original CRISPR CATTGCAACCATGAGCTCTG GGG (reversed) Intergenic
No off target data available for this crispr