ID: 937427396

View in Genome Browser
Species Human (GRCh38)
Location 2:121811809-121811831
Sequence GACTTTGCAAGGTCTTTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937427396_937427406 27 Left 937427396 2:121811809-121811831 CCTAAGAAAGACCTTGCAAAGTC No data
Right 937427406 2:121811859-121811881 GCTACCCTTACACCCTTTGTGGG No data
937427396_937427404 5 Left 937427396 2:121811809-121811831 CCTAAGAAAGACCTTGCAAAGTC No data
Right 937427404 2:121811837-121811859 CCTTGGAGGCATCTTTGTTAGGG No data
937427396_937427399 -9 Left 937427396 2:121811809-121811831 CCTAAGAAAGACCTTGCAAAGTC No data
Right 937427399 2:121811823-121811845 TGCAAAGTCCCAAGCCTTGGAGG No data
937427396_937427402 4 Left 937427396 2:121811809-121811831 CCTAAGAAAGACCTTGCAAAGTC No data
Right 937427402 2:121811836-121811858 GCCTTGGAGGCATCTTTGTTAGG No data
937427396_937427405 26 Left 937427396 2:121811809-121811831 CCTAAGAAAGACCTTGCAAAGTC No data
Right 937427405 2:121811858-121811880 GGCTACCCTTACACCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937427396 Original CRISPR GACTTTGCAAGGTCTTTCTT AGG (reversed) Intergenic